Incidental Mutation 'R9164:Map1b'
ID 695941
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 068944-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 99568816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1302 (E1302*)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect probably null
Transcript: ENSMUST00000064762
AA Change: E1302*
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1302*

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,278,157 (GRCm39) E3112D probably damaging Het
Abtb2 C T 2: 103,541,829 (GRCm39) T847I possibly damaging Het
Acox1 A T 11: 116,089,173 (GRCm39) H48Q probably benign Het
Adam9 A G 8: 25,486,795 (GRCm39) I161T possibly damaging Het
Ankrd50 A G 3: 38,511,204 (GRCm39) Y388H probably damaging Het
Arap1 A T 7: 101,041,090 (GRCm39) K593* probably null Het
Bicc1 G A 10: 70,781,094 (GRCm39) T661M probably damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Celf1 T A 2: 90,831,426 (GRCm39) L85H probably damaging Het
Cep120 A T 18: 53,852,318 (GRCm39) M520K probably benign Het
Cfap91 A G 16: 38,155,960 (GRCm39) Y88H possibly damaging Het
Chd1l C T 3: 97,501,356 (GRCm39) R230H probably benign Het
Cyp2c55 A T 19: 38,995,571 (GRCm39) K28* probably null Het
D930048N14Rik A T 11: 51,545,609 (GRCm39) H167L unknown Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dock4 T A 12: 40,754,337 (GRCm39) I442N probably damaging Het
Dpp6 T C 5: 27,656,286 (GRCm39) probably null Het
Dysf T C 6: 84,180,308 (GRCm39) C1960R probably damaging Het
Gm13941 T C 2: 110,936,324 (GRCm39) S2G unknown Het
Gm37240 T C 3: 84,417,248 (GRCm39) N157S possibly damaging Het
Gp1ba A G 11: 70,531,283 (GRCm39) I350V unknown Het
Gtf3c4 A G 2: 28,724,661 (GRCm39) V357A probably benign Het
Hemgn T C 4: 46,396,106 (GRCm39) I377V probably benign Het
Hsd3b3 T C 3: 98,660,689 (GRCm39) D28G probably benign Het
Intu A T 3: 40,645,133 (GRCm39) D508V probably damaging Het
Kif28 A T 1: 179,533,333 (GRCm39) M604K probably damaging Het
Klra6 T A 6: 129,993,687 (GRCm39) I195F possibly damaging Het
Lhfpl6 G A 3: 52,950,887 (GRCm39) V54I probably benign Het
Lrpap1 T C 5: 35,262,923 (GRCm39) Y38C probably damaging Het
Map7 C T 10: 20,122,410 (GRCm39) R159C probably benign Het
Mov10l1 C T 15: 88,896,361 (GRCm39) T735I probably benign Het
Nfasc C A 1: 132,562,544 (GRCm39) R77L probably damaging Het
Nipsnap1 T C 11: 4,839,969 (GRCm39) V230A probably benign Het
Or4c11 C T 2: 88,695,795 (GRCm39) P282L possibly damaging Het
Or7e166 T A 9: 19,624,954 (GRCm39) M277K probably benign Het
Or7e169 T A 9: 19,757,504 (GRCm39) N137I possibly damaging Het
Orm3 T C 4: 63,274,809 (GRCm39) L39P probably damaging Het
Pcdhb19 T A 18: 37,631,852 (GRCm39) V549E probably damaging Het
Pclo T A 5: 14,731,699 (GRCm39) S274R Het
Phactr1 A G 13: 42,836,178 (GRCm39) D2G possibly damaging Het
Phtf2 G A 5: 21,008,190 (GRCm39) R164* probably null Het
Prkcq A G 2: 11,231,716 (GRCm39) D13G probably damaging Het
Proser1 A T 3: 53,379,494 (GRCm39) N156I probably benign Het
Prss51 T C 14: 64,334,958 (GRCm39) I171T probably damaging Het
Ptbp2 G A 3: 119,546,640 (GRCm39) P81S probably damaging Het
Ptk2b T C 14: 66,404,222 (GRCm39) D681G possibly damaging Het
Rigi T A 4: 40,208,827 (GRCm39) M762L probably damaging Het
Slc7a12 A T 3: 14,564,360 (GRCm39) I349F probably damaging Het
Sorcs2 G T 5: 36,235,312 (GRCm39) T240K possibly damaging Het
Sowahc C A 10: 59,057,897 (GRCm39) A11E probably benign Het
Spag1 A T 15: 36,216,399 (GRCm39) Y526F probably damaging Het
Stim1 A G 7: 102,084,626 (GRCm39) H526R probably benign Het
Stx1b T C 7: 127,414,159 (GRCm39) K69R probably benign Het
Tal1 T C 4: 114,920,646 (GRCm39) S107P probably benign Het
Tas2r130 T C 6: 131,606,975 (GRCm39) I273M probably damaging Het
Ttc24 A T 3: 87,980,295 (GRCm39) Y135* probably null Het
Ttn G A 2: 76,583,856 (GRCm39) P22384S probably damaging Het
Vmn2r14 T G 5: 109,364,087 (GRCm39) T610P probably damaging Het
Vmn2r84 T A 10: 130,221,669 (GRCm39) *850C probably null Het
Vwf T A 6: 125,542,806 (GRCm39) I94N Het
Zan A T 5: 137,422,333 (GRCm39) S2762T unknown Het
Zbtb20 A G 16: 43,430,764 (GRCm39) Q352R probably benign Het
Zfc3h1 T C 10: 115,259,374 (GRCm39) Y1649H probably benign Het
Zfp397 A T 18: 24,089,828 (GRCm39) Q111L probably damaging Het
Zfp616 T A 11: 73,975,825 (GRCm39) I698N probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGCCTCACTGAATTCAAAGC -3'
(R):5'- AAAGCCAGTGCCGAGTTAG -3'

Sequencing Primer
(F):5'- AAGCTCACTGGAACTGCCTG -3'
(R):5'- TTTCAGATGAGAGACTTAGCCCAGC -3'
Posted On 2022-02-07