Incidental Mutation 'R9164:Map1b'
ID 695941
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 99432308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1302 (E1302*)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect probably null
Transcript: ENSMUST00000064762
AA Change: E1302*
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1302*

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGCCTCACTGAATTCAAAGC -3'
(R):5'- AAAGCCAGTGCCGAGTTAG -3'

Sequencing Primer
(F):5'- AAGCTCACTGGAACTGCCTG -3'
(R):5'- TTTCAGATGAGAGACTTAGCCCAGC -3'
Posted On 2022-02-07