Mutagenetix > Incidental Mutation

Incidental Mutation 'R9164:Zbtb20'

695948

Institutional Source

Beutler Lab

Gene Symbol

Zbtb20

Ensembl Gene

ENSMUSG00000022708

Gene Name

zinc finger and BTB domain containing 20

Synonyms

Zfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik

MMRRC Submission

068944-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42875881-43642602 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43610401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 352 (Q352R)

Ref Sequence

ENSEMBL: ENSMUSP00000110339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]

AlphaFold

Q8K0L9

Predicted Effect

probably benign
Transcript: ENSMUST00000079441
AA Change: Q425R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: Q425R

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114690
AA Change: Q352R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: Q352R

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114691
AA Change: Q352R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: Q352R

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114694
AA Change: Q425R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: Q425R

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114695
AA Change: Q425R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: Q425R

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146708

SMART Domains

Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	74	3.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148775

SMART Domains

Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	60	9.8e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156367

SMART Domains

Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	94	131	1.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156981

SMART Domains

Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART

Meta Mutation Damage Score

0.0736

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,328,157	E3112D	probably damaging	Het
Abtb2	C	T	2: 103,711,484	T847I	possibly damaging	Het
Acox1	A	T	11: 116,198,347	H48Q	probably benign	Het
Adam9	A	G	8: 24,996,779	I161T	possibly damaging	Het
Ankrd50	A	G	3: 38,457,055	Y388H	probably damaging	Het
Arap1	A	T	7: 101,391,883	K593*	probably null	Het
Bicc1	G	A	10: 70,945,264	T661M	probably damaging	Het
Cela1	A	G	15: 100,682,885		probably null	Het
Celf1	T	A	2: 91,001,081	L85H	probably damaging	Het
Cep120	A	T	18: 53,719,246	M520K	probably benign	Het
Chd1l	C	T	3: 97,594,040	R230H	probably benign	Het
Cyp2c55	A	T	19: 39,007,127	K28*	probably null	Het
D930048N14Rik	A	T	11: 51,654,782	H167L	unknown	Het
Ddx58	T	A	4: 40,208,827	M762L	probably damaging	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dock4	T	A	12: 40,704,338	I442N	probably damaging	Het
Dpp6	T	C	5: 27,451,288		probably null	Het
Dysf	T	C	6: 84,203,326	C1960R	probably damaging	Het
Gm13941	T	C	2: 111,105,979	S2G	unknown	Het
Gm37240	T	C	3: 84,509,941	N157S	possibly damaging	Het
Gp1ba	A	G	11: 70,640,457	I350V	unknown	Het
Gtf3c4	A	G	2: 28,834,649	V357A	probably benign	Het
Hemgn	T	C	4: 46,396,106	I377V	probably benign	Het
Hsd3b3	T	C	3: 98,753,373	D28G	probably benign	Het
Intu	A	T	3: 40,690,703	D508V	probably damaging	Het
Kif28	A	T	1: 179,705,768	M604K	probably damaging	Het
Klra6	T	A	6: 130,016,724	I195F	possibly damaging	Het
Lhfp	G	A	3: 53,043,466	V54I	probably benign	Het
Lrpap1	T	C	5: 35,105,579	Y38C	probably damaging	Het
Maats1	A	G	16: 38,335,598	Y88H	possibly damaging	Het
Map1b	T	A	13: 99,425,843	Q2453L	unknown	Het
Map1b	C	A	13: 99,432,308	E1302*	probably null	Het
Map7	C	T	10: 20,246,664	R159C	probably benign	Het
Mov10l1	C	T	15: 89,012,158	T735I	probably benign	Het
Nfasc	C	A	1: 132,634,806	R77L	probably damaging	Het
Nipsnap1	T	C	11: 4,889,969	V230A	probably benign	Het
Olfr1206	C	T	2: 88,865,451	P282L	possibly damaging	Het
Olfr857	T	A	9: 19,713,658	M277K	probably benign	Het
Olfr860	T	A	9: 19,846,208	N137I	possibly damaging	Het
Orm3	T	C	4: 63,356,572	L39P	probably damaging	Het
Pcdhb19	T	A	18: 37,498,799	V549E	probably damaging	Het
Pclo	T	A	5: 14,681,685	S274R		Het
Phactr1	A	G	13: 42,682,702	D2G	possibly damaging	Het
Phtf2	G	A	5: 20,803,192	R164*	probably null	Het
Prkcq	A	G	2: 11,226,905	D13G	probably damaging	Het
Proser1	A	T	3: 53,472,073	N156I	probably benign	Het
Prss51	T	C	14: 64,097,509	I171T	probably damaging	Het
Ptbp2	G	A	3: 119,752,991	P81S	probably damaging	Het
Ptk2b	T	C	14: 66,166,773	D681G	possibly damaging	Het
Slc7a12	A	T	3: 14,499,300	I349F	probably damaging	Het
Sorcs2	G	T	5: 36,077,968	T240K	possibly damaging	Het
Sowahc	C	A	10: 59,222,075	A11E	probably benign	Het
Spag1	A	T	15: 36,216,253	Y526F	probably damaging	Het
Stim1	A	G	7: 102,435,419	H526R	probably benign	Het
Stx1b	T	C	7: 127,814,987	K69R	probably benign	Het
Tal1	T	C	4: 115,063,449	S107P	probably benign	Het
Tas2r130	T	C	6: 131,630,012	I273M	probably damaging	Het
Ttc24	A	T	3: 88,072,988	Y135*	probably null	Het
Ttn	G	A	2: 76,753,512	P22384S	probably damaging	Het
Vmn2r14	T	G	5: 109,216,221	T610P	probably damaging	Het
Vmn2r84	T	A	10: 130,385,800	*850C	probably null	Het
Vwf	T	A	6: 125,565,843	I94N		Het
Zan	A	T	5: 137,424,071	S2762T	unknown	Het
Zfc3h1	T	C	10: 115,423,469	Y1649H	probably benign	Het
Zfp397	A	T	18: 23,956,771	Q111L	probably damaging	Het
Zfp616	T	A	11: 74,084,999	I698N	probably damaging	Het

Other mutations in Zbtb20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Zbtb20	APN	16	43610661	missense	possibly damaging	0.85
IGL02170:Zbtb20	APN	16	43609662	missense	possibly damaging	0.84
IGL02292:Zbtb20	APN	16	43610648	nonsense	probably null
IGL02733:Zbtb20	APN	16	43609933	missense	possibly damaging	0.48
IGL03277:Zbtb20	APN	16	43618437	missense	possibly damaging	0.95
siberian	UTSW	16	43610676	missense	probably damaging	0.96
Tiger	UTSW	16	43618398	missense	probably damaging	0.98
Towering	UTSW	16	43610867	nonsense	probably null
R0310:Zbtb20	UTSW	16	43609746	missense	probably damaging	0.98
R1593:Zbtb20	UTSW	16	43609423	missense	probably damaging	0.99
R1996:Zbtb20	UTSW	16	43610080	missense	probably damaging	0.98
R2018:Zbtb20	UTSW	16	43577652	missense	possibly damaging	0.86
R2050:Zbtb20	UTSW	16	43609612	splice site	probably null
R2097:Zbtb20	UTSW	16	43609519	missense	probably null	1.00
R4006:Zbtb20	UTSW	16	43609399	missense	probably damaging	1.00
R4708:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4710:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4835:Zbtb20	UTSW	16	43618398	missense	probably damaging	0.98
R4962:Zbtb20	UTSW	16	43618692	missense	probably damaging	0.99
R5531:Zbtb20	UTSW	16	43610867	nonsense	probably null
R7452:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R7523:Zbtb20	UTSW	16	43610512	missense	probably benign	0.01
R8175:Zbtb20	UTSW	16	43577080	intron	probably benign
R8306:Zbtb20	UTSW	16	43618737	missense	probably damaging	0.99
R8811:Zbtb20	UTSW	16	43610494	missense	probably benign
R8922:Zbtb20	UTSW	16	43577605	missense	probably damaging	0.99
R9687:Zbtb20	UTSW	16	43609797	missense	possibly damaging	0.83
Z1176:Zbtb20	UTSW	16	43610530	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AGTGCACAGAAGACACTGAC -3'
(R):5'- TGGTCAAGGTCAGAGGCATC -3'

Sequencing Primer
(F):5'- CACTGACCAAGCAGAGGGC -3'
(R):5'- AGGCATCCTCAGGTTGCTG -3'

Posted On

2022-02-07