Incidental Mutation 'R9165:Sirpb1b'
ID 695965
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Name signal-regulatory protein beta 1B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 15495751-15575065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15574904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000088869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382] [ENSMUST00000195778]
AlphaFold A0A0A6YXN8
Predicted Effect probably damaging
Transcript: ENSMUST00000091319
AA Change: L16P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: L16P

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192382
AA Change: L16P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195778
AA Change: L16P
SMART Domains Protein: ENSMUSP00000141533
Gene: ENSMUSG00000095028
AA Change: L16P

DomainStartEndE-ValueType
Pfam:Ig_2 14 66 5.6e-1 PFAM
Pfam:Ig_3 22 52 7.8e-3 PFAM
Pfam:V-set 24 75 1.9e-7 PFAM
IGc1 96 169 5.1e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15548729 missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15543184 missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15548803 missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15548596 missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15548759 missense possibly damaging 0.81
R3935:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R4300:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4373:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15548827 missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15548669 missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15548665 missense probably damaging 1.00
R6357:Sirpb1b UTSW 3 15503183 missense possibly damaging 0.79
R6723:Sirpb1b UTSW 3 15548798 missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15542170 missense probably benign 0.25
R7390:Sirpb1b UTSW 3 15543040 nonsense probably null
R7411:Sirpb1b UTSW 3 15542997 missense probably benign 0.22
R7513:Sirpb1b UTSW 3 15542140 nonsense probably null
R7526:Sirpb1b UTSW 3 15548872 missense probably damaging 1.00
R8352:Sirpb1b UTSW 3 15542350 missense probably benign 0.03
R8452:Sirpb1b UTSW 3 15542350 missense probably benign 0.03
R8794:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
V7583:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
Z1177:Sirpb1b UTSW 3 15574941 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTCACATTCCAGTTCAGGC -3'
(R):5'- AAGCTGCATGCAACACTGTTTAG -3'

Sequencing Primer
(F):5'- TCAGGCAGTGCTCAGAATTC -3'
(R):5'- AAGCAGTATGGTTCCTGTTTTCAC -3'
Posted On 2022-02-07