Mutagenetix > Incidental Mutation

Incidental Mutation 'R9165:Acacb'

695980

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

068945-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9165 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114216683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1206 (E1206G)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: E1206G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: E1206G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: E1206G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: E1206G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,615,244	I248V	probably benign	Het
1700122O11Rik	T	C	17: 48,037,548	I27V	probably benign	Het
A2ml1	T	A	6: 128,560,669	H693L	probably benign	Het
Acoxl	A	G	2: 127,884,512	T269A	probably benign	Het
Ak9	A	G	10: 41,433,239	K1879R	unknown	Het
Amot	A	T	X: 145,461,749	L435H		Het
Bnc2	A	T	4: 84,411,494	L95Q		Het
Bpifa2	G	T	2: 154,009,821	W59L	probably benign	Het
Cd209a	T	A	8: 3,745,602	Q156H	probably damaging	Het
Cep104	T	A	4: 153,994,514		probably null	Het
Cpt1c	A	G	7: 44,959,501	*799R	probably null	Het
Csn2	A	T	5: 87,694,559	M203K	possibly damaging	Het
Dclre1a	C	G	19: 56,538,369	A872P	probably damaging	Het
Dlg5	C	A	14: 24,146,241	L1629F	probably damaging	Het
Dmxl1	A	G	18: 49,878,925	D1383G	probably damaging	Het
Dnah6	A	G	6: 73,144,941	V1381A	probably damaging	Het
Dnttip2	G	T	3: 122,276,706	E523D	probably benign	Het
Dync2h1	A	T	9: 7,114,883	V2425D	probably damaging	Het
Eif2a	G	A	3: 58,545,274	R199Q	probably damaging	Het
F10	T	C	8: 13,039,564	F60L	probably benign	Het
Faf2	A	G	13: 54,652,138	I253V	probably benign	Het
Fam71a	A	G	1: 191,163,061	S462P	probably benign	Het
Flt1	T	A	5: 147,615,237	S715C	probably damaging	Het
Gm2056	A	G	12: 88,027,307	S102G	possibly damaging	Het
Gm5150	G	T	3: 15,990,896	T55K	probably damaging	Het
Gria1	T	C	11: 57,185,933	F121L	possibly damaging	Het
Gucy2d	A	G	7: 98,454,064	Q505R	probably benign	Het
Gzma	A	T	13: 113,100,921	S11T	probably benign	Het
Hoxa6	G	A	6: 52,208,555	Q24*	probably null	Het
Kcnj14	T	A	7: 45,819,644	I146L	possibly damaging	Het
Kiss1r	G	A	10: 79,920,771	R149H	probably damaging	Het
Lama2	A	G	10: 27,053,026		probably null	Het
Lama5	C	A	2: 180,179,493	R3092L	probably damaging	Het
Lca5l	T	A	16: 96,176,018	N196I	probably damaging	Het
Lig4	A	G	8: 9,972,394	L462S	probably damaging	Het
Nbea	A	T	3: 56,004,868	V1166E	probably benign	Het
Nr2c1	T	A	10: 94,181,603	F401Y	probably benign	Het
Olfr1335	T	A	4: 118,808,998	R289*	probably null	Het
Olfr1431	A	T	19: 12,209,922	M119L	probably damaging	Het
Olfr1507	A	G	14: 52,490,373	I197T	possibly damaging	Het
Olfr299	A	T	7: 86,465,617	M69L	probably benign	Het
Otop3	A	C	11: 115,344,598	Y352S	possibly damaging	Het
Plekha6	T	G	1: 133,272,637	L318R	probably damaging	Het
Pm20d1	G	T	1: 131,816,087	V497F	possibly damaging	Het
Pnma2	G	A	14: 66,917,123	R332H	probably damaging	Het
Ppip5k1	C	A	2: 121,331,564	G1013C	probably damaging	Het
Prdm13	C	G	4: 21,679,659	R277P	unknown	Het
Prdm2	A	G	4: 143,132,104	S1539P	possibly damaging	Het
Ptger2	A	G	14: 44,989,778	T272A	probably damaging	Het
Qser1	T	C	2: 104,788,470	T576A	probably benign	Het
Rest	GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC	GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC	5: 77,281,804		probably benign	Het
Sacm1l	G	T	9: 123,568,956	V238L	probably damaging	Het
Sec16a	C	T	2: 26,423,633	G454D		Het
Sil1	A	G	18: 35,317,846	S259P	possibly damaging	Het
Sirpb1b	A	G	3: 15,574,904	L16P	probably damaging	Het
Slc22a20	A	T	19: 5,982,851	V262D	probably damaging	Het
Slc4a9	G	T	18: 36,533,623	R580L	probably benign	Het
Ssr3	A	G	3: 65,383,100	V128A	probably damaging	Het
Stpg2	G	T	3: 139,309,232	S386I	possibly damaging	Het
Taar8c	C	A	10: 24,101,602	C104F	probably damaging	Het
Tex2	T	C	11: 106,567,269	E445G	unknown	Het
Tmem253	A	C	14: 52,018,642	D126A	probably benign	Het
Tox4	A	G	14: 52,285,790	Q69R	possibly damaging	Het
Tpi1	T	A	6: 124,811,538	S254C	probably benign	Het
Trmt12	T	G	15: 58,873,745	S331A	probably benign	Het
Ttn	A	G	2: 76,713,006	V33212A	probably damaging	Het
Tubb4a	C	T	17: 57,080,734	E431K	unknown	Het
Ugt1a10	A	T	1: 88,055,787	E102D	probably benign	Het
Unc80	A	T	1: 66,549,841	E1055V	probably null	Het
Vav1	C	A	17: 57,311,895	S708R	probably damaging	Het
Vmn1r20	A	G	6: 57,432,261	M191V	probably damaging	Het
Vmn1r37	A	T	6: 66,732,070	T227S	probably damaging	Het
Vmn1r72	C	A	7: 11,679,024		probably benign	Het
Vps33b	G	A	7: 80,274,686		probably null	Het
Vrtn	T	A	12: 84,650,477	L667Q	probably benign	Het
Xirp1	G	A	9: 120,018,236	T527M	probably benign	Het
Ylpm1	T	A	12: 85,030,568	Y1356N	probably damaging	Het
Zfp980	A	T	4: 145,701,454	Y251F	possibly damaging	Het
Zmym2	A	T	14: 56,948,007	Y1032F	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAACTGGCTAGATGTGTTTAGAGAG -3'
(R):5'- AGATGGACTCCACCTGGTTGTG -3'

Sequencing Primer
(F):5'- ACCACCTGTAATGGGATCTGATGC -3'
(R):5'- TTGTGCCGCAGCTCGTAG -3'

Posted On

2022-02-07