Incidental Mutation 'R9165:Acacb'
ID 695980
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114146535-114250761 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114216683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1206 (E1206G)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: E1206G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: E1206G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: E1206G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: E1206G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
acetone UTSW 5 114226857 nonsense probably null
anabolism UTSW 5 114245220 missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
R8678:Acacb UTSW 5 114201971 nonsense probably null
R8693:Acacb UTSW 5 114226783 missense probably damaging 0.99
R8697:Acacb UTSW 5 114213380 missense probably damaging 0.96
R8772:Acacb UTSW 5 114184118 missense possibly damaging 0.73
R8918:Acacb UTSW 5 114195254 missense probably damaging 1.00
R9044:Acacb UTSW 5 114235517 missense probably benign 0.00
R9231:Acacb UTSW 5 114211092 missense probably benign 0.01
R9440:Acacb UTSW 5 114246024 missense possibly damaging 0.56
R9444:Acacb UTSW 5 114245959 missense probably damaging 0.99
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAACTGGCTAGATGTGTTTAGAGAG -3'
(R):5'- AGATGGACTCCACCTGGTTGTG -3'

Sequencing Primer
(F):5'- ACCACCTGTAATGGGATCTGATGC -3'
(R):5'- TTGTGCCGCAGCTCGTAG -3'
Posted On 2022-02-07