Incidental Mutation 'R9165:Vps33b'
ID 695991
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Name vacuolar protein sorting 33B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80269649-80291754 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 80274686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]
AlphaFold P59016
Predicted Effect probably null
Transcript: ENSMUST00000032749
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 splice site probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 splice site probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 splice site probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0267:Vps33b UTSW 7 80286054 missense possibly damaging 0.87
R0379:Vps33b UTSW 7 80283414 splice site probably null
R0971:Vps33b UTSW 7 80287899 missense possibly damaging 0.75
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R1693:Vps33b UTSW 7 80287893 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5083:Vps33b UTSW 7 80274641 missense probably damaging 0.99
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
R8025:Vps33b UTSW 7 80290346 splice site probably benign
R8460:Vps33b UTSW 7 80287869 missense probably benign 0.04
R8930:Vps33b UTSW 7 80282493 missense possibly damaging 0.89
R8932:Vps33b UTSW 7 80282493 missense possibly damaging 0.89
R9065:Vps33b UTSW 7 80285591 missense probably damaging 0.99
R9110:Vps33b UTSW 7 80289995 missense probably benign 0.04
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGACAGTCAGCTCACCTGG -3'
(R):5'- GCAGACTAACAATCTGAGTGCC -3'

Sequencing Primer
(F):5'- ATTTTAGTGGGATGAGAACAGACTG -3'
(R):5'- GTGCCATATTATTTAACAACCAGTGC -3'
Posted On 2022-02-07