Incidental Mutation 'R9165:Lig4'
ID 695995
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Name ligase IV, DNA, ATP-dependent
Synonyms DNA ligase IV, 5830471N16Rik, tiny
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 9969049-9977686 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9972394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 462 (L462S)
Ref Sequence ENSEMBL: ENSMUSP00000093130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095476] [ENSMUST00000170033]
AlphaFold Q8BTF7
Predicted Effect probably damaging
Transcript: ENSMUST00000095476
AA Change: L462S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: L462S

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170033
AA Change: L462S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: L462S

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
nosegay UTSW 8 9972954 missense probably damaging 1.00
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB004:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8113:Lig4 UTSW 8 9973485 missense probably benign 0.07
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
R8443:Lig4 UTSW 8 9973777 start codon destroyed probably null 0.00
R8956:Lig4 UTSW 8 9971378 missense probably benign
R9170:Lig4 UTSW 8 9972202 missense probably damaging 1.00
R9356:Lig4 UTSW 8 9972538 missense possibly damaging 0.94
R9535:Lig4 UTSW 8 9972325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAAGGCTTCCAGTATTTTGCC -3'
(R):5'- CAAGGCCGCATAGAAATAGTGC -3'

Sequencing Primer
(F):5'- TTGCCAATTTCAAGCCCAGG -3'
(R):5'- TAGTGCAGAAAACTCAAGCTCATAC -3'
Posted On 2022-02-07