Incidental Mutation 'R9165:Olfr1507'
ID 696018
Institutional Source Beutler Lab
Gene Symbol Olfr1507
Ensembl Gene ENSMUSG00000059887
Gene Name olfactory receptor 1507
Synonyms MOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52488791-52495749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52490373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 197 (I197T)
Ref Sequence ENSEMBL: ENSMUSP00000146152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]
AlphaFold Q0VEP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000073571
AA Change: I197T

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: I197T

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 305 3.6e-9 PFAM
Pfam:7tm_1 44 290 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205963
Predicted Effect possibly damaging
Transcript: ENSMUST00000206062
AA Change: I197T

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000206069
Predicted Effect probably benign
Transcript: ENSMUST00000206931
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Olfr1507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr1507 APN 14 52490748 missense probably damaging 1.00
IGL01367:Olfr1507 APN 14 52490167 missense probably benign 0.42
IGL01664:Olfr1507 APN 14 52490545 missense probably benign 0.01
IGL02890:Olfr1507 APN 14 52490911 missense probably benign
IGL03108:Olfr1507 APN 14 52490076 missense probably damaging 0.97
IGL03184:Olfr1507 APN 14 52490923 missense probably benign 0.20
R0563:Olfr1507 UTSW 14 52490257 nonsense probably null
R1080:Olfr1507 UTSW 14 52490585 nonsense probably null
R1558:Olfr1507 UTSW 14 52490146 missense probably benign 0.26
R1653:Olfr1507 UTSW 14 52490772 missense probably damaging 1.00
R1714:Olfr1507 UTSW 14 52490414 splice site probably null
R1720:Olfr1507 UTSW 14 52490594 nonsense probably null
R3430:Olfr1507 UTSW 14 52490425 missense possibly damaging 0.92
R4995:Olfr1507 UTSW 14 52490531 nonsense probably null
R5954:Olfr1507 UTSW 14 52490167 missense probably benign 0.42
R6183:Olfr1507 UTSW 14 52490731 missense probably benign 0.05
R6518:Olfr1507 UTSW 14 52490620 missense probably damaging 1.00
R6651:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6652:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6653:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R7385:Olfr1507 UTSW 14 52490181 missense probably damaging 1.00
R7524:Olfr1507 UTSW 14 52490293 missense probably damaging 1.00
R8902:Olfr1507 UTSW 14 52490553 missense probably benign 0.02
X0025:Olfr1507 UTSW 14 52490466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTCCCAGAAACAGAGTGAC -3'
(R):5'- GATCGCTATGTGGCCATTTG -3'

Sequencing Primer
(F):5'- ACTACGGTGAGATGGGCTGC -3'
(R):5'- GATCGCTATGTGGCCATTTGTAAACC -3'
Posted On 2022-02-07