Incidental Mutation 'R9165:Slc4a9'
ID 696027
Institutional Source Beutler Lab
Gene Symbol Slc4a9
Ensembl Gene ENSMUSG00000024485
Gene Name solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms AE4, D630024F24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 36528157-36541293 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 36533623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 580 (R580L)
Ref Sequence ENSEMBL: ENSMUSP00000111358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]
AlphaFold A0A494BA31
Predicted Effect probably benign
Transcript: ENSMUST00000074298
AA Change: R508L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485
AA Change: R508L

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 174 4.6e-19 PFAM
Pfam:Band_3_cyto 161 300 7.1e-45 PFAM
Pfam:HCO3_cotransp 367 788 2.7e-168 PFAM
transmembrane domain 794 816 N/A INTRINSIC
low complexity region 830 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115694
AA Change: R580L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485
AA Change: R580L

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 170 1.9e-15 PFAM
Pfam:Band_3_cyto 159 300 1e-38 PFAM
Pfam:HCO3_cotransp 349 805 3.1e-174 PFAM
Pfam:HCO3_cotransp 801 837 1.1e-11 PFAM
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 879 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Ak9 A G 10: 41,433,239 K1879R unknown Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Slc4a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc4a9 APN 18 36539596 splice site probably benign
IGL01890:Slc4a9 APN 18 36529707 missense possibly damaging 0.63
IGL01995:Slc4a9 APN 18 36539775 missense possibly damaging 0.64
IGL02293:Slc4a9 APN 18 36533215 missense probably benign 0.00
IGL02476:Slc4a9 APN 18 36535445 critical splice donor site probably null
IGL02690:Slc4a9 APN 18 36531987 missense probably damaging 1.00
IGL02726:Slc4a9 APN 18 36539617 missense probably benign 0.24
IGL03003:Slc4a9 APN 18 36536893 missense probably damaging 1.00
IGL03344:Slc4a9 APN 18 36535601 missense probably damaging 1.00
IGL03410:Slc4a9 APN 18 36529687 missense probably benign
R0025:Slc4a9 UTSW 18 36531666 splice site probably benign
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0330:Slc4a9 UTSW 18 36535539 missense probably damaging 1.00
R0457:Slc4a9 UTSW 18 36535418 missense probably damaging 1.00
R0831:Slc4a9 UTSW 18 36535278 splice site probably benign
R0989:Slc4a9 UTSW 18 36536867 nonsense probably null
R1016:Slc4a9 UTSW 18 36531425 missense probably benign 0.12
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1598:Slc4a9 UTSW 18 36528371 nonsense probably null
R1710:Slc4a9 UTSW 18 36532022 missense probably benign
R2041:Slc4a9 UTSW 18 36530793 missense possibly damaging 0.93
R2216:Slc4a9 UTSW 18 36530745 missense probably benign 0.05
R3899:Slc4a9 UTSW 18 36535563 missense probably benign 0.09
R5236:Slc4a9 UTSW 18 36530847 missense probably benign
R5902:Slc4a9 UTSW 18 36529333 splice site probably null
R5902:Slc4a9 UTSW 18 36531507 missense probably damaging 1.00
R5978:Slc4a9 UTSW 18 36535403 missense probably damaging 1.00
R6438:Slc4a9 UTSW 18 36535687 missense probably benign 0.00
R6452:Slc4a9 UTSW 18 36531459 missense probably damaging 1.00
R7238:Slc4a9 UTSW 18 36529720 missense probably benign 0.00
R7329:Slc4a9 UTSW 18 36540821 missense possibly damaging 0.76
R7409:Slc4a9 UTSW 18 36530805 missense probably damaging 0.99
R7649:Slc4a9 UTSW 18 36528377 missense probably benign 0.16
R7694:Slc4a9 UTSW 18 36536849 missense probably damaging 0.99
R7856:Slc4a9 UTSW 18 36528698 missense probably benign 0.04
R8523:Slc4a9 UTSW 18 36532143 missense possibly damaging 0.91
R9003:Slc4a9 UTSW 18 36540734 critical splice acceptor site probably null
R9475:Slc4a9 UTSW 18 36529216 missense probably null 1.00
R9509:Slc4a9 UTSW 18 36535390 missense probably damaging 0.98
Z1177:Slc4a9 UTSW 18 36531428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTAGTGCTCTTTGGCTCTCC -3'
(R):5'- AAACCAGACTTTTCACGCAGG -3'

Sequencing Primer
(F):5'- GAAGAAAGCTTCCCTGGTCTTCAG -3'
(R):5'- CTTTTCACGCAGGAAAGAAAAATGAC -3'
Posted On 2022-02-07