Incidental Mutation 'R9166:Bltp1'
ID 696042
Institutional Source Beutler Lab
Gene Symbol Bltp1
Ensembl Gene ENSMUSG00000037270
Gene Name bridge-like lipid transfer protein family member 1
Synonyms FSA, 4932438A13Rik, Tweek
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9166 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36917253-37107182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37041516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2630 (N2630K)
Ref Sequence ENSEMBL: ENSMUSP00000060199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000211820]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057272
AA Change: N2630K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: N2630K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152564
AA Change: N2630K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: N2630K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211820
AA Change: N2631K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A G 16: 90,853,046 (GRCm39) L30P possibly damaging Het
Adgrb1 A C 15: 74,420,475 (GRCm39) M875L probably benign Het
Amot A T X: 144,244,745 (GRCm39) L435H Het
Ankrd13c T A 3: 157,705,357 (GRCm39) S427T probably benign Het
Aopep G A 13: 63,318,862 (GRCm39) probably null Het
Ap3b1 A C 13: 94,608,236 (GRCm39) Y569S probably damaging Het
Bco2 A G 9: 50,447,667 (GRCm39) V352A probably benign Het
Cacnb1 T A 11: 97,910,534 (GRCm39) D48V probably damaging Het
Cdr2l C A 11: 115,283,537 (GRCm39) Q132K probably benign Het
Chrd T C 16: 20,554,572 (GRCm39) M377T probably benign Het
Coq7 T C 7: 118,109,365 (GRCm39) T228A unknown Het
D7Ertd443e G A 7: 133,900,048 (GRCm39) T438I probably benign Het
Dlc1 C T 8: 37,066,589 (GRCm39) E15K probably damaging Het
Dlgap5 C T 14: 47,651,206 (GRCm39) R109Q probably damaging Het
Dysf T C 6: 84,126,959 (GRCm39) V1359A probably damaging Het
E2f7 C T 10: 110,618,085 (GRCm39) P717S probably benign Het
Elmo2 T C 2: 165,132,438 (GRCm39) D669G probably benign Het
Epha6 A G 16: 60,425,238 (GRCm39) V125A probably benign Het
Erg G T 16: 95,190,807 (GRCm39) H119N probably benign Het
Fam13b T C 18: 34,595,252 (GRCm39) S371G probably benign Het
Fancg G C 4: 43,006,800 (GRCm39) Q297E probably benign Het
Gas2 A G 7: 51,586,323 (GRCm39) E145G possibly damaging Het
Gas7 T C 11: 67,561,446 (GRCm39) V218A probably benign Het
Gm9970 A G 5: 31,398,345 (GRCm39) S78P unknown Het
Hectd4 A C 5: 121,446,690 (GRCm39) D259A probably damaging Het
Hoxb2 T G 11: 96,244,339 (GRCm39) S317A probably damaging Het
Hspg2 T C 4: 137,270,185 (GRCm39) L2381P probably damaging Het
Irf4 A T 13: 30,941,484 (GRCm39) H280L probably benign Het
Irf7 A G 7: 140,844,666 (GRCm39) V142A probably benign Het
Kat7 T C 11: 95,190,928 (GRCm39) I94V probably benign Het
Kera T A 10: 97,448,830 (GRCm39) I350K possibly damaging Het
Klf15 T C 6: 90,443,952 (GRCm39) S176P probably benign Het
Lrrc59 C A 11: 94,522,959 (GRCm39) T53N probably benign Het
Morn5 T C 2: 35,945,024 (GRCm39) Y83H probably damaging Het
Myef2l A G 3: 10,153,849 (GRCm39) N206S probably benign Het
Neil3 A C 8: 54,058,722 (GRCm39) M273R probably damaging Het
Ngfr A T 11: 95,465,047 (GRCm39) V267E possibly damaging Het
Nudc T C 4: 133,273,165 (GRCm39) D11G probably damaging Het
Or2t1 A T 14: 14,329,059 (GRCm38) D316V probably benign Het
Or4a81 T A 2: 89,619,291 (GRCm39) N135I probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pik3cg C T 12: 32,242,213 (GRCm39) G966R probably damaging Het
Ppfibp1 A G 6: 146,920,980 (GRCm39) T573A probably damaging Het
Ppp2r5a C A 1: 191,128,504 (GRCm39) R37L probably benign Het
Prpf8 T C 11: 75,387,340 (GRCm39) F1207S possibly damaging Het
Prtg A T 9: 72,764,107 (GRCm39) I527F probably damaging Het
Pspc1 A G 14: 56,999,305 (GRCm39) M317T probably damaging Het
Ptpru C T 4: 131,525,180 (GRCm39) V768I probably benign Het
Ptx4 A G 17: 25,343,546 (GRCm39) probably null Het
Ralgapb T C 2: 158,274,842 (GRCm39) probably null Het
Rhobtb2 C A 14: 70,034,703 (GRCm39) G174V probably damaging Het
Sdad1 G T 5: 92,446,080 (GRCm39) S285* probably null Het
Sema4f G T 6: 82,890,626 (GRCm39) S727* probably null Het
Sik1 A G 17: 32,069,727 (GRCm39) F241L probably damaging Het
Slc8b1 T C 5: 120,662,096 (GRCm39) S279P probably benign Het
Slco4a1 A G 2: 180,106,034 (GRCm39) E72G probably benign Het
Smok3c A T 5: 138,063,781 (GRCm39) T423S possibly damaging Het
Sorcs3 T C 19: 48,784,811 (GRCm39) V1078A probably benign Het
Sptb A G 12: 76,673,776 (GRCm39) V337A probably damaging Het
Tet2 C A 3: 133,173,933 (GRCm39) G1443V probably damaging Het
Ticam2 A T 18: 46,694,048 (GRCm39) L13H probably damaging Het
Tnrc6a A G 7: 122,786,624 (GRCm39) E1562G probably damaging Het
Trim24 A T 6: 37,934,074 (GRCm39) K742N probably damaging Het
Trim56 A T 5: 137,142,751 (GRCm39) V255E probably damaging Het
Trmt12 A G 15: 58,744,608 (GRCm39) E2G probably benign Het
Tubd1 A T 11: 86,452,091 (GRCm39) T353S probably benign Het
Vim T C 2: 13,579,556 (GRCm39) V105A probably benign Het
Vmn2r58 A T 7: 41,513,431 (GRCm39) V404E probably damaging Het
Wdr62 G A 7: 29,941,874 (GRCm39) P1115L probably damaging Het
Wfdc12 G T 2: 164,032,193 (GRCm39) C32* probably null Het
Zfp750 T A 11: 121,403,980 (GRCm39) R298S probably damaging Het
Other mutations in Bltp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Bltp1 APN 3 37,065,876 (GRCm39) missense probably benign 0.00
IGL00434:Bltp1 APN 3 37,041,448 (GRCm39) missense probably damaging 0.98
IGL00640:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00693:Bltp1 APN 3 37,106,696 (GRCm39) utr 3 prime probably benign
IGL00721:Bltp1 APN 3 37,084,900 (GRCm39) splice site probably null
IGL00756:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00896:Bltp1 APN 3 37,093,611 (GRCm39) missense probably benign
IGL00902:Bltp1 APN 3 37,095,494 (GRCm39) missense probably damaging 1.00
IGL00980:Bltp1 APN 3 37,054,190 (GRCm39) missense probably damaging 1.00
IGL01019:Bltp1 APN 3 37,061,133 (GRCm39) critical splice acceptor site probably null
IGL01025:Bltp1 APN 3 37,100,429 (GRCm39) missense possibly damaging 0.89
IGL01306:Bltp1 APN 3 37,059,162 (GRCm39) splice site probably benign
IGL01370:Bltp1 APN 3 37,001,904 (GRCm39) missense probably benign 0.07
IGL01377:Bltp1 APN 3 37,027,601 (GRCm39) critical splice donor site probably null
IGL01401:Bltp1 APN 3 36,996,441 (GRCm39) missense probably benign
IGL01419:Bltp1 APN 3 37,102,270 (GRCm39) missense probably damaging 1.00
IGL01432:Bltp1 APN 3 37,057,908 (GRCm39) missense possibly damaging 0.87
IGL01433:Bltp1 APN 3 36,941,919 (GRCm39) missense probably damaging 1.00
IGL01452:Bltp1 APN 3 37,050,457 (GRCm39) unclassified probably benign
IGL01520:Bltp1 APN 3 37,027,409 (GRCm39) nonsense probably null
IGL01524:Bltp1 APN 3 36,996,531 (GRCm39) missense possibly damaging 0.90
IGL01628:Bltp1 APN 3 37,062,634 (GRCm39) missense probably damaging 1.00
IGL01638:Bltp1 APN 3 37,028,460 (GRCm39) missense probably damaging 1.00
IGL01650:Bltp1 APN 3 37,046,822 (GRCm39) splice site probably benign
IGL01717:Bltp1 APN 3 37,088,885 (GRCm39) missense probably benign
IGL01767:Bltp1 APN 3 37,095,512 (GRCm39) missense probably benign 0.29
IGL01813:Bltp1 APN 3 36,982,669 (GRCm39) missense possibly damaging 0.90
IGL01998:Bltp1 APN 3 37,011,165 (GRCm39) missense possibly damaging 0.49
IGL02172:Bltp1 APN 3 37,059,022 (GRCm39) missense probably damaging 0.99
IGL02197:Bltp1 APN 3 36,960,884 (GRCm39) missense probably damaging 1.00
IGL02248:Bltp1 APN 3 37,023,439 (GRCm39) critical splice donor site probably null
IGL02273:Bltp1 APN 3 36,975,586 (GRCm39) splice site probably benign
IGL02403:Bltp1 APN 3 37,084,813 (GRCm39) missense probably benign
IGL02492:Bltp1 APN 3 37,102,262 (GRCm39) missense probably benign 0.04
IGL02517:Bltp1 APN 3 37,013,017 (GRCm39) missense probably damaging 1.00
IGL02519:Bltp1 APN 3 36,949,464 (GRCm39) missense probably damaging 1.00
IGL02586:Bltp1 APN 3 37,098,757 (GRCm39) nonsense probably null
IGL02620:Bltp1 APN 3 37,090,094 (GRCm39) missense possibly damaging 0.95
IGL02621:Bltp1 APN 3 37,095,633 (GRCm39) splice site probably benign
IGL02670:Bltp1 APN 3 37,021,454 (GRCm39) nonsense probably null
IGL02806:Bltp1 APN 3 37,000,643 (GRCm39) missense possibly damaging 0.95
IGL02985:Bltp1 APN 3 37,012,906 (GRCm39) missense probably damaging 0.99
IGL03004:Bltp1 APN 3 37,019,826 (GRCm39) splice site probably benign
IGL03037:Bltp1 APN 3 37,023,356 (GRCm39) missense probably benign 0.23
IGL03037:Bltp1 APN 3 37,023,357 (GRCm39) missense probably damaging 1.00
IGL03062:Bltp1 APN 3 37,092,666 (GRCm39) splice site probably benign
IGL03137:Bltp1 APN 3 37,088,751 (GRCm39) missense probably damaging 0.98
IGL03150:Bltp1 APN 3 37,002,215 (GRCm39) missense probably damaging 1.00
IGL03204:Bltp1 APN 3 37,105,083 (GRCm39) splice site probably benign
IGL03207:Bltp1 APN 3 37,004,145 (GRCm39) missense possibly damaging 0.73
IGL03256:Bltp1 APN 3 36,960,832 (GRCm39) splice site probably benign
IGL03264:Bltp1 APN 3 37,056,784 (GRCm39) missense probably damaging 1.00
IGL03265:Bltp1 APN 3 37,102,140 (GRCm39) missense probably benign 0.00
IGL03303:Bltp1 APN 3 36,924,226 (GRCm39) missense possibly damaging 0.90
admonished UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
alerted UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
informed UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
resolved UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
tipped UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
warned UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
FR4340:Bltp1 UTSW 3 37,104,901 (GRCm39) critical splice acceptor site probably benign
FR4737:Bltp1 UTSW 3 37,104,903 (GRCm39) critical splice acceptor site probably benign
PIT4515001:Bltp1 UTSW 3 37,028,385 (GRCm39) missense probably damaging 1.00
R0035:Bltp1 UTSW 3 37,041,747 (GRCm39) nonsense probably null
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0092:Bltp1 UTSW 3 37,082,308 (GRCm39) missense probably benign 0.41
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0256:Bltp1 UTSW 3 36,971,922 (GRCm39) missense probably benign 0.01
R0277:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0321:Bltp1 UTSW 3 36,960,937 (GRCm39) splice site probably null
R0323:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0335:Bltp1 UTSW 3 37,023,301 (GRCm39) missense probably damaging 1.00
R0375:Bltp1 UTSW 3 37,100,401 (GRCm39) missense probably damaging 0.99
R0437:Bltp1 UTSW 3 37,043,953 (GRCm39) missense possibly damaging 0.81
R0445:Bltp1 UTSW 3 37,054,214 (GRCm39) missense probably damaging 0.99
R0496:Bltp1 UTSW 3 37,041,784 (GRCm39) missense probably damaging 1.00
R0531:Bltp1 UTSW 3 37,090,974 (GRCm39) missense probably damaging 1.00
R0543:Bltp1 UTSW 3 37,050,607 (GRCm39) missense probably benign 0.22
R0545:Bltp1 UTSW 3 37,041,839 (GRCm39) splice site probably benign
R0674:Bltp1 UTSW 3 37,098,775 (GRCm39) missense possibly damaging 0.86
R0745:Bltp1 UTSW 3 36,982,612 (GRCm39) missense probably damaging 1.00
R0755:Bltp1 UTSW 3 37,000,513 (GRCm39) missense probably damaging 1.00
R0785:Bltp1 UTSW 3 37,013,483 (GRCm39) splice site probably benign
R1056:Bltp1 UTSW 3 37,098,829 (GRCm39) missense probably benign 0.44
R1056:Bltp1 UTSW 3 37,037,602 (GRCm39) missense possibly damaging 0.69
R1080:Bltp1 UTSW 3 37,042,404 (GRCm39) missense probably damaging 1.00
R1103:Bltp1 UTSW 3 37,050,672 (GRCm39) missense probably benign
R1119:Bltp1 UTSW 3 37,041,194 (GRCm39) missense probably damaging 1.00
R1170:Bltp1 UTSW 3 37,098,780 (GRCm39) missense probably damaging 0.98
R1183:Bltp1 UTSW 3 36,949,452 (GRCm39) missense possibly damaging 0.51
R1186:Bltp1 UTSW 3 37,050,461 (GRCm39) unclassified probably benign
R1201:Bltp1 UTSW 3 37,002,524 (GRCm39) missense probably benign
R1219:Bltp1 UTSW 3 37,000,619 (GRCm39) nonsense probably null
R1270:Bltp1 UTSW 3 37,006,333 (GRCm39) missense probably damaging 1.00
R1273:Bltp1 UTSW 3 37,041,359 (GRCm39) missense probably damaging 1.00
R1338:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1364:Bltp1 UTSW 3 37,041,179 (GRCm39) missense probably damaging 1.00
R1437:Bltp1 UTSW 3 36,996,578 (GRCm39) missense possibly damaging 0.65
R1447:Bltp1 UTSW 3 37,019,735 (GRCm39) missense probably damaging 0.98
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1481:Bltp1 UTSW 3 37,062,583 (GRCm39) missense probably damaging 0.99
R1528:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1533:Bltp1 UTSW 3 37,095,524 (GRCm39) missense probably damaging 1.00
R1546:Bltp1 UTSW 3 36,924,205 (GRCm39) missense possibly damaging 0.64
R1606:Bltp1 UTSW 3 36,996,548 (GRCm39) missense probably damaging 1.00
R1638:Bltp1 UTSW 3 37,089,961 (GRCm39) nonsense probably null
R1772:Bltp1 UTSW 3 37,013,581 (GRCm39) missense probably damaging 1.00
R1896:Bltp1 UTSW 3 36,962,380 (GRCm39) nonsense probably null
R1919:Bltp1 UTSW 3 37,061,132 (GRCm39) critical splice acceptor site probably null
R1983:Bltp1 UTSW 3 36,942,014 (GRCm39) missense probably null 1.00
R1987:Bltp1 UTSW 3 37,008,134 (GRCm39) critical splice donor site probably null
R1992:Bltp1 UTSW 3 37,054,181 (GRCm39) missense probably benign 0.32
R1999:Bltp1 UTSW 3 36,962,360 (GRCm39) missense probably damaging 1.00
R2004:Bltp1 UTSW 3 36,949,527 (GRCm39) missense possibly damaging 0.77
R2010:Bltp1 UTSW 3 36,982,700 (GRCm39) missense probably benign 0.09
R2027:Bltp1 UTSW 3 37,102,110 (GRCm39) splice site probably benign
R2039:Bltp1 UTSW 3 37,058,027 (GRCm39) missense possibly damaging 0.66
R2054:Bltp1 UTSW 3 37,002,002 (GRCm39) missense probably benign 0.01
R2089:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,008,119 (GRCm39) missense probably damaging 1.00
R2220:Bltp1 UTSW 3 36,929,679 (GRCm39) critical splice donor site probably null
R2374:Bltp1 UTSW 3 36,939,545 (GRCm39) missense probably benign 0.00
R2437:Bltp1 UTSW 3 37,012,834 (GRCm39) splice site probably null
R2860:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2861:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2909:Bltp1 UTSW 3 37,002,102 (GRCm39) missense probably damaging 1.00
R2925:Bltp1 UTSW 3 37,061,271 (GRCm39) missense probably damaging 0.99
R2940:Bltp1 UTSW 3 37,012,954 (GRCm39) missense probably damaging 1.00
R3015:Bltp1 UTSW 3 36,929,611 (GRCm39) missense probably damaging 1.00
R3086:Bltp1 UTSW 3 37,065,852 (GRCm39) missense possibly damaging 0.56
R3159:Bltp1 UTSW 3 37,013,564 (GRCm39) missense probably benign 0.17
R3440:Bltp1 UTSW 3 37,096,061 (GRCm39) nonsense probably null
R3703:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3705:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3795:Bltp1 UTSW 3 37,084,714 (GRCm39) missense probably benign 0.30
R3820:Bltp1 UTSW 3 37,094,583 (GRCm39) missense probably damaging 1.00
R3862:Bltp1 UTSW 3 36,939,547 (GRCm39) missense possibly damaging 0.73
R3944:Bltp1 UTSW 3 37,084,210 (GRCm39) missense possibly damaging 0.90
R4020:Bltp1 UTSW 3 37,066,724 (GRCm39) intron probably benign
R4091:Bltp1 UTSW 3 37,084,738 (GRCm39) missense probably benign 0.00
R4159:Bltp1 UTSW 3 36,985,232 (GRCm39) missense probably benign 0.00
R4231:Bltp1 UTSW 3 36,974,385 (GRCm39) missense probably benign 0.10
R4368:Bltp1 UTSW 3 37,042,296 (GRCm39) nonsense probably null
R4413:Bltp1 UTSW 3 37,012,830 (GRCm39) splice site probably null
R4475:Bltp1 UTSW 3 37,094,544 (GRCm39) missense probably damaging 1.00
R4488:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4489:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4516:Bltp1 UTSW 3 36,949,460 (GRCm39) missense possibly damaging 0.90
R4580:Bltp1 UTSW 3 37,084,174 (GRCm39) missense probably benign 0.02
R4672:Bltp1 UTSW 3 36,944,139 (GRCm39) makesense probably null
R4705:Bltp1 UTSW 3 37,096,038 (GRCm39) missense probably benign 0.03
R4735:Bltp1 UTSW 3 37,059,116 (GRCm39) missense possibly damaging 0.84
R4741:Bltp1 UTSW 3 36,996,524 (GRCm39) missense probably damaging 0.99
R4754:Bltp1 UTSW 3 37,076,615 (GRCm39) nonsense probably null
R4778:Bltp1 UTSW 3 36,991,214 (GRCm39) missense possibly damaging 0.90
R4833:Bltp1 UTSW 3 37,019,117 (GRCm39) missense probably damaging 0.96
R4896:Bltp1 UTSW 3 37,020,086 (GRCm39) missense probably damaging 1.00
R4910:Bltp1 UTSW 3 37,052,348 (GRCm39) missense probably damaging 1.00
R4922:Bltp1 UTSW 3 37,041,314 (GRCm39) missense probably damaging 1.00
R4941:Bltp1 UTSW 3 36,974,050 (GRCm39) missense probably benign 0.41
R4941:Bltp1 UTSW 3 36,971,851 (GRCm39) missense probably damaging 1.00
R4980:Bltp1 UTSW 3 36,997,461 (GRCm39) missense probably damaging 1.00
R5030:Bltp1 UTSW 3 36,997,548 (GRCm39) intron probably benign
R5049:Bltp1 UTSW 3 37,095,539 (GRCm39) missense probably damaging 1.00
R5049:Bltp1 UTSW 3 37,094,655 (GRCm39) intron probably benign
R5089:Bltp1 UTSW 3 37,041,651 (GRCm39) missense probably benign 0.02
R5092:Bltp1 UTSW 3 37,054,234 (GRCm39) missense probably benign 0.14
R5122:Bltp1 UTSW 3 37,088,906 (GRCm39) splice site probably null
R5210:Bltp1 UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
R5246:Bltp1 UTSW 3 37,102,199 (GRCm39) missense probably damaging 1.00
R5289:Bltp1 UTSW 3 37,054,258 (GRCm39) missense probably damaging 0.97
R5348:Bltp1 UTSW 3 37,102,295 (GRCm39) missense probably damaging 1.00
R5394:Bltp1 UTSW 3 36,971,817 (GRCm39) missense probably damaging 1.00
R5434:Bltp1 UTSW 3 36,929,665 (GRCm39) missense probably damaging 1.00
R5667:Bltp1 UTSW 3 36,971,826 (GRCm39) missense probably benign 0.00
R5686:Bltp1 UTSW 3 36,971,809 (GRCm39) missense probably benign 0.00
R5701:Bltp1 UTSW 3 36,975,509 (GRCm39) missense probably benign 0.10
R5778:Bltp1 UTSW 3 37,012,863 (GRCm39) missense probably damaging 1.00
R5787:Bltp1 UTSW 3 37,046,882 (GRCm39) splice site probably null
R5800:Bltp1 UTSW 3 37,106,592 (GRCm39) missense probably damaging 1.00
R5819:Bltp1 UTSW 3 37,102,749 (GRCm39) missense probably benign 0.12
R5820:Bltp1 UTSW 3 37,093,675 (GRCm39) missense probably benign 0.00
R5952:Bltp1 UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
R5975:Bltp1 UTSW 3 37,023,370 (GRCm39) missense possibly damaging 0.64
R5996:Bltp1 UTSW 3 36,985,265 (GRCm39) missense probably benign 0.07
R6192:Bltp1 UTSW 3 37,042,318 (GRCm39) missense probably benign 0.00
R6225:Bltp1 UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
R6234:Bltp1 UTSW 3 37,037,620 (GRCm39) missense probably benign 0.00
R6244:Bltp1 UTSW 3 37,011,148 (GRCm39) missense probably benign
R6263:Bltp1 UTSW 3 36,985,260 (GRCm39) missense probably benign 0.06
R6351:Bltp1 UTSW 3 36,962,377 (GRCm39) missense probably damaging 1.00
R6380:Bltp1 UTSW 3 37,087,456 (GRCm39) missense probably benign 0.19
R6468:Bltp1 UTSW 3 37,062,592 (GRCm39) missense probably damaging 1.00
R6759:Bltp1 UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
R6792:Bltp1 UTSW 3 37,065,715 (GRCm39) critical splice acceptor site probably null
R6809:Bltp1 UTSW 3 36,928,431 (GRCm39) missense probably damaging 0.98
R6841:Bltp1 UTSW 3 37,075,630 (GRCm39) missense probably damaging 1.00
R6959:Bltp1 UTSW 3 37,021,338 (GRCm39) missense probably damaging 1.00
R7102:Bltp1 UTSW 3 36,994,947 (GRCm39) missense probably damaging 0.99
R7188:Bltp1 UTSW 3 37,004,162 (GRCm39) missense probably benign 0.06
R7212:Bltp1 UTSW 3 37,102,158 (GRCm39) missense
R7425:Bltp1 UTSW 3 37,037,543 (GRCm39) missense probably benign 0.02
R7425:Bltp1 UTSW 3 37,002,490 (GRCm39) missense probably benign
R7451:Bltp1 UTSW 3 37,076,956 (GRCm39) splice site probably null
R7604:Bltp1 UTSW 3 37,003,992 (GRCm39) splice site probably null
R7622:Bltp1 UTSW 3 37,002,562 (GRCm39) nonsense probably null
R7671:Bltp1 UTSW 3 36,997,380 (GRCm39) missense probably damaging 0.99
R7699:Bltp1 UTSW 3 37,080,303 (GRCm39) missense probably benign 0.00
R7699:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7700:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7700:Bltp1 UTSW 3 37,080,303 (GRCm39) missense probably benign 0.00
R7748:Bltp1 UTSW 3 37,013,484 (GRCm39) critical splice acceptor site probably null
R7767:Bltp1 UTSW 3 36,974,436 (GRCm39) critical splice donor site probably null
R7787:Bltp1 UTSW 3 36,939,557 (GRCm39) missense probably damaging 1.00
R7830:Bltp1 UTSW 3 37,019,081 (GRCm39) frame shift probably null
R7849:Bltp1 UTSW 3 37,080,477 (GRCm39) missense
R7912:Bltp1 UTSW 3 37,061,218 (GRCm39) missense probably damaging 0.99
R7914:Bltp1 UTSW 3 37,000,432 (GRCm39) missense probably benign 0.13
R7945:Bltp1 UTSW 3 37,020,042 (GRCm39) missense probably benign 0.03
R8039:Bltp1 UTSW 3 36,997,363 (GRCm39) missense probably benign 0.12
R8101:Bltp1 UTSW 3 37,062,651 (GRCm39) missense probably damaging 1.00
R8143:Bltp1 UTSW 3 37,000,657 (GRCm39) critical splice donor site probably null
R8145:Bltp1 UTSW 3 37,052,416 (GRCm39) missense probably damaging 1.00
R8171:Bltp1 UTSW 3 37,029,862 (GRCm39) missense probably benign 0.00
R8210:Bltp1 UTSW 3 37,067,030 (GRCm39) missense
R8250:Bltp1 UTSW 3 36,971,811 (GRCm39) missense probably damaging 0.99
R8369:Bltp1 UTSW 3 37,065,752 (GRCm39) missense
R8478:Bltp1 UTSW 3 37,087,426 (GRCm39) missense possibly damaging 0.74
R8558:Bltp1 UTSW 3 37,102,750 (GRCm39) missense
R8688:Bltp1 UTSW 3 37,090,066 (GRCm39) missense
R8724:Bltp1 UTSW 3 36,945,042 (GRCm39) missense probably damaging 0.99
R8818:Bltp1 UTSW 3 37,050,697 (GRCm39) missense possibly damaging 0.60
R8869:Bltp1 UTSW 3 37,013,007 (GRCm39) missense probably damaging 0.99
R8887:Bltp1 UTSW 3 37,087,503 (GRCm39) missense possibly damaging 0.95
R8899:Bltp1 UTSW 3 37,042,429 (GRCm39) missense probably damaging 1.00
R8907:Bltp1 UTSW 3 37,002,295 (GRCm39) nonsense probably null
R8960:Bltp1 UTSW 3 37,067,132 (GRCm39) missense probably damaging 1.00
R8990:Bltp1 UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
R9021:Bltp1 UTSW 3 37,052,493 (GRCm39) missense probably benign 0.00
R9048:Bltp1 UTSW 3 37,065,926 (GRCm39) missense
R9100:Bltp1 UTSW 3 37,098,907 (GRCm39) missense
R9176:Bltp1 UTSW 3 37,010,852 (GRCm39) missense possibly damaging 0.82
R9202:Bltp1 UTSW 3 36,944,970 (GRCm39) missense probably benign
R9303:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9305:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9332:Bltp1 UTSW 3 37,104,989 (GRCm39) missense
R9362:Bltp1 UTSW 3 37,011,162 (GRCm39) missense probably benign
R9493:Bltp1 UTSW 3 37,065,885 (GRCm39) missense
R9534:Bltp1 UTSW 3 37,052,419 (GRCm39) missense probably benign 0.01
R9569:Bltp1 UTSW 3 37,066,770 (GRCm39) missense
R9593:Bltp1 UTSW 3 37,002,090 (GRCm39) missense probably damaging 1.00
R9600:Bltp1 UTSW 3 37,095,565 (GRCm39) nonsense probably null
R9733:Bltp1 UTSW 3 37,102,732 (GRCm39) missense
R9751:Bltp1 UTSW 3 37,065,889 (GRCm39) missense
RF013:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
RF015:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF021:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF023:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF034:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF035:Bltp1 UTSW 3 37,104,907 (GRCm39) critical splice acceptor site probably benign
RF055:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
X0050:Bltp1 UTSW 3 37,011,277 (GRCm39) missense probably damaging 1.00
Z1088:Bltp1 UTSW 3 37,041,716 (GRCm39) missense probably damaging 1.00
Z1177:Bltp1 UTSW 3 37,037,589 (GRCm39) missense possibly damaging 0.88
Z1177:Bltp1 UTSW 3 36,974,099 (GRCm39) missense probably benign
Z1177:Bltp1 UTSW 3 37,090,856 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCAGCATGTGGATATGGCTC -3'
(R):5'- AGGCTCACTTTGCTCTGACAC -3'

Sequencing Primer
(F):5'- GATATGGCTCTGGTCCGTCTTATC -3'
(R):5'- CACTGTGATGGAATCGGAATCATCC -3'
Posted On 2022-02-07