Incidental Mutation 'R9166:Smok3c'
ID 696054
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Name sperm motility kinase 3C
Synonyms EG622486
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R9166 (G1)
Quality Score 202.009
Status Not validated
Chromosome 5
Chromosomal Location 138053194-138066537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138065519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 423 (T423S)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
AlphaFold A0A087WSF2
Predicted Effect possibly damaging
Transcript: ENSMUST00000110967
AA Change: T423S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: T423S

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178402
AA Change: T423S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: T423S

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,171,048 probably null Het
4932438A13Rik T A 3: 36,987,367 N2630K probably damaging Het
4932438H23Rik A G 16: 91,056,158 L30P possibly damaging Het
Adgrb1 A C 15: 74,548,626 M875L probably benign Het
Amot A T X: 145,461,749 L435H Het
Ankrd13c T A 3: 157,999,720 S427T probably benign Het
Ap3b1 A C 13: 94,471,728 Y569S probably damaging Het
Bco2 A G 9: 50,536,367 V352A probably benign Het
Cacnb1 T A 11: 98,019,708 D48V probably damaging Het
Cdr2l C A 11: 115,392,711 Q132K probably benign Het
Chrd T C 16: 20,735,822 M377T probably benign Het
Coq7 T C 7: 118,510,142 T228A unknown Het
D7Ertd443e G A 7: 134,298,319 T438I probably benign Het
Dlc1 C T 8: 36,599,435 E15K probably damaging Het
Dlgap5 C T 14: 47,413,749 R109Q probably damaging Het
Dysf T C 6: 84,149,977 V1359A probably damaging Het
E2f7 C T 10: 110,782,224 P717S probably benign Het
Elmo2 T C 2: 165,290,518 D669G probably benign Het
Epha6 A G 16: 60,604,875 V125A probably benign Het
Erg G T 16: 95,389,948 H119N probably benign Het
Fam13b T C 18: 34,462,199 S371G probably benign Het
Fancg G C 4: 43,006,800 Q297E probably benign Het
Gas2 A G 7: 51,936,575 E145G possibly damaging Het
Gas7 T C 11: 67,670,620 V218A probably benign Het
Gm9833 A G 3: 10,088,789 N206S probably benign Het
Gm9970 A G 5: 31,241,001 S78P unknown Het
Hectd4 A C 5: 121,308,627 D259A probably damaging Het
Hoxb2 T G 11: 96,353,513 S317A probably damaging Het
Hspg2 T C 4: 137,542,874 L2381P probably damaging Het
Irf4 A T 13: 30,757,501 H280L probably benign Het
Irf7 A G 7: 141,264,753 V142A probably benign Het
Kat7 T C 11: 95,300,102 I94V probably benign Het
Kera T A 10: 97,612,968 I350K possibly damaging Het
Klf15 T C 6: 90,466,970 S176P probably benign Het
Lrrc59 C A 11: 94,632,133 T53N probably benign Het
Morn5 T C 2: 36,055,012 Y83H probably damaging Het
Neil3 A C 8: 53,605,687 M273R probably damaging Het
Ngfr A T 11: 95,574,221 V267E possibly damaging Het
Nudc T C 4: 133,545,854 D11G probably damaging Het
Olfr1254 T A 2: 89,788,947 N135I probably damaging Het
Olfr31 A T 14: 14,329,059 D316V probably benign Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pik3cg C T 12: 32,192,214 G966R probably damaging Het
Ppfibp1 A G 6: 147,019,482 T573A probably damaging Het
Ppp2r5a C A 1: 191,396,307 R37L probably benign Het
Prpf8 T C 11: 75,496,514 F1207S possibly damaging Het
Prtg A T 9: 72,856,825 I527F probably damaging Het
Pspc1 A G 14: 56,761,848 M317T probably damaging Het
Ptpru C T 4: 131,797,869 V768I probably benign Het
Ptx4 A G 17: 25,124,572 probably null Het
Ralgapb T C 2: 158,432,922 probably null Het
Rhobtb2 C A 14: 69,797,254 G174V probably damaging Het
Sdad1 G T 5: 92,298,221 S285* probably null Het
Sema4f G T 6: 82,913,645 S727* probably null Het
Sik1 A G 17: 31,850,753 F241L probably damaging Het
Slc8b1 T C 5: 120,524,031 S279P probably benign Het
Slco4a1 A G 2: 180,464,241 E72G probably benign Het
Sorcs3 T C 19: 48,796,372 V1078A probably benign Het
Sptb A G 12: 76,627,002 V337A probably damaging Het
Tet2 C A 3: 133,468,172 G1443V probably damaging Het
Ticam2 A T 18: 46,560,981 L13H probably damaging Het
Tnrc6a A G 7: 123,187,401 E1562G probably damaging Het
Trim24 A T 6: 37,957,139 K742N probably damaging Het
Trim56 A T 5: 137,113,897 V255E probably damaging Het
Trmt12 A G 15: 58,872,759 E2G probably benign Het
Tubd1 A T 11: 86,561,265 T353S probably benign Het
Vim T C 2: 13,574,745 V105A probably benign Het
Vmn2r58 A T 7: 41,864,007 V404E probably damaging Het
Wdr62 G A 7: 30,242,449 P1115L probably damaging Het
Wfdc12 G T 2: 164,190,273 C32* probably null Het
Zfp750 T A 11: 121,513,154 R298S probably damaging Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R7962:Smok3c UTSW 5 138065079 missense probably damaging 0.98
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138065393 missense probably benign 0.00
R8381:Smok3c UTSW 5 138065562 missense probably benign
R8841:Smok3c UTSW 5 138065275 missense probably damaging 0.99
R9369:Smok3c UTSW 5 138065508 missense probably damaging 0.98
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTACTACCTGTCTCGGAC -3'
(R):5'- CCCAGGTGAGATGTCTCTTTGG -3'

Sequencing Primer
(F):5'- TCTCGGACTTCGCAGGAGAG -3'
(R):5'- CTCTTTGGATGGGATACAGCAAC -3'
Posted On 2022-02-07