Incidental Mutation 'R9166:E2f7'
ID 696073
Institutional Source Beutler Lab
Gene Symbol E2f7
Ensembl Gene ENSMUSG00000020185
Gene Name E2F transcription factor 7
Synonyms D10Ertd739e, A630014C11Rik, E2F7
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R9166 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 110581300-110623245 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110618085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 717 (P717S)
Ref Sequence ENSEMBL: ENSMUSP00000073453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073781] [ENSMUST00000173471]
AlphaFold Q6S7F2
Predicted Effect probably benign
Transcript: ENSMUST00000073781
AA Change: P717S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073453
Gene: ENSMUSG00000020185
AA Change: P717S

DomainStartEndE-ValueType
E2F_TDP 143 212 1.12e-28 SMART
E2F_TDP 283 368 1.28e-32 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 755 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173471
AA Change: P717S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133494
Gene: ENSMUSG00000020185
AA Change: P717S

DomainStartEndE-ValueType
Pfam:E2F_TDP 143 212 1.8e-23 PFAM
Pfam:E2F_TDP 283 368 3.7e-24 PFAM
low complexity region 591 602 N/A INTRINSIC
low complexity region 755 767 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] E2F transcription factors, such as E2F7, play an essential role in the regulation of cell cycle progression (Di Stefano et al., 2003 [PubMed 14633988]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop normally through puberty and survive to old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A G 16: 90,853,046 (GRCm39) L30P possibly damaging Het
Adgrb1 A C 15: 74,420,475 (GRCm39) M875L probably benign Het
Amot A T X: 144,244,745 (GRCm39) L435H Het
Ankrd13c T A 3: 157,705,357 (GRCm39) S427T probably benign Het
Aopep G A 13: 63,318,862 (GRCm39) probably null Het
Ap3b1 A C 13: 94,608,236 (GRCm39) Y569S probably damaging Het
Bco2 A G 9: 50,447,667 (GRCm39) V352A probably benign Het
Bltp1 T A 3: 37,041,516 (GRCm39) N2630K probably damaging Het
Cacnb1 T A 11: 97,910,534 (GRCm39) D48V probably damaging Het
Cdr2l C A 11: 115,283,537 (GRCm39) Q132K probably benign Het
Chrd T C 16: 20,554,572 (GRCm39) M377T probably benign Het
Coq7 T C 7: 118,109,365 (GRCm39) T228A unknown Het
D7Ertd443e G A 7: 133,900,048 (GRCm39) T438I probably benign Het
Dlc1 C T 8: 37,066,589 (GRCm39) E15K probably damaging Het
Dlgap5 C T 14: 47,651,206 (GRCm39) R109Q probably damaging Het
Dysf T C 6: 84,126,959 (GRCm39) V1359A probably damaging Het
Elmo2 T C 2: 165,132,438 (GRCm39) D669G probably benign Het
Epha6 A G 16: 60,425,238 (GRCm39) V125A probably benign Het
Erg G T 16: 95,190,807 (GRCm39) H119N probably benign Het
Fam13b T C 18: 34,595,252 (GRCm39) S371G probably benign Het
Fancg G C 4: 43,006,800 (GRCm39) Q297E probably benign Het
Gas2 A G 7: 51,586,323 (GRCm39) E145G possibly damaging Het
Gas7 T C 11: 67,561,446 (GRCm39) V218A probably benign Het
Gm9970 A G 5: 31,398,345 (GRCm39) S78P unknown Het
Hectd4 A C 5: 121,446,690 (GRCm39) D259A probably damaging Het
Hoxb2 T G 11: 96,244,339 (GRCm39) S317A probably damaging Het
Hspg2 T C 4: 137,270,185 (GRCm39) L2381P probably damaging Het
Irf4 A T 13: 30,941,484 (GRCm39) H280L probably benign Het
Irf7 A G 7: 140,844,666 (GRCm39) V142A probably benign Het
Kat7 T C 11: 95,190,928 (GRCm39) I94V probably benign Het
Kera T A 10: 97,448,830 (GRCm39) I350K possibly damaging Het
Klf15 T C 6: 90,443,952 (GRCm39) S176P probably benign Het
Lrrc59 C A 11: 94,522,959 (GRCm39) T53N probably benign Het
Morn5 T C 2: 35,945,024 (GRCm39) Y83H probably damaging Het
Myef2l A G 3: 10,153,849 (GRCm39) N206S probably benign Het
Neil3 A C 8: 54,058,722 (GRCm39) M273R probably damaging Het
Ngfr A T 11: 95,465,047 (GRCm39) V267E possibly damaging Het
Nudc T C 4: 133,273,165 (GRCm39) D11G probably damaging Het
Or2t1 A T 14: 14,329,059 (GRCm38) D316V probably benign Het
Or4a81 T A 2: 89,619,291 (GRCm39) N135I probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pik3cg C T 12: 32,242,213 (GRCm39) G966R probably damaging Het
Ppfibp1 A G 6: 146,920,980 (GRCm39) T573A probably damaging Het
Ppp2r5a C A 1: 191,128,504 (GRCm39) R37L probably benign Het
Prpf8 T C 11: 75,387,340 (GRCm39) F1207S possibly damaging Het
Prtg A T 9: 72,764,107 (GRCm39) I527F probably damaging Het
Pspc1 A G 14: 56,999,305 (GRCm39) M317T probably damaging Het
Ptpru C T 4: 131,525,180 (GRCm39) V768I probably benign Het
Ptx4 A G 17: 25,343,546 (GRCm39) probably null Het
Ralgapb T C 2: 158,274,842 (GRCm39) probably null Het
Rhobtb2 C A 14: 70,034,703 (GRCm39) G174V probably damaging Het
Sdad1 G T 5: 92,446,080 (GRCm39) S285* probably null Het
Sema4f G T 6: 82,890,626 (GRCm39) S727* probably null Het
Sik1 A G 17: 32,069,727 (GRCm39) F241L probably damaging Het
Slc8b1 T C 5: 120,662,096 (GRCm39) S279P probably benign Het
Slco4a1 A G 2: 180,106,034 (GRCm39) E72G probably benign Het
Smok3c A T 5: 138,063,781 (GRCm39) T423S possibly damaging Het
Sorcs3 T C 19: 48,784,811 (GRCm39) V1078A probably benign Het
Sptb A G 12: 76,673,776 (GRCm39) V337A probably damaging Het
Tet2 C A 3: 133,173,933 (GRCm39) G1443V probably damaging Het
Ticam2 A T 18: 46,694,048 (GRCm39) L13H probably damaging Het
Tnrc6a A G 7: 122,786,624 (GRCm39) E1562G probably damaging Het
Trim24 A T 6: 37,934,074 (GRCm39) K742N probably damaging Het
Trim56 A T 5: 137,142,751 (GRCm39) V255E probably damaging Het
Trmt12 A G 15: 58,744,608 (GRCm39) E2G probably benign Het
Tubd1 A T 11: 86,452,091 (GRCm39) T353S probably benign Het
Vim T C 2: 13,579,556 (GRCm39) V105A probably benign Het
Vmn2r58 A T 7: 41,513,431 (GRCm39) V404E probably damaging Het
Wdr62 G A 7: 29,941,874 (GRCm39) P1115L probably damaging Het
Wfdc12 G T 2: 164,032,193 (GRCm39) C32* probably null Het
Zfp750 T A 11: 121,403,980 (GRCm39) R298S probably damaging Het
Other mutations in E2f7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:E2f7 APN 10 110,589,954 (GRCm39) missense probably benign 0.09
IGL01592:E2f7 APN 10 110,582,267 (GRCm39) missense possibly damaging 0.86
IGL01614:E2f7 APN 10 110,595,839 (GRCm39) missense probably damaging 1.00
IGL01829:E2f7 APN 10 110,614,955 (GRCm39) missense probably benign 0.00
IGL01843:E2f7 APN 10 110,610,596 (GRCm39) missense probably benign 0.01
IGL02683:E2f7 APN 10 110,618,320 (GRCm39) missense probably benign 0.28
IGL03229:E2f7 APN 10 110,590,207 (GRCm39) missense probably benign 0.04
R0245:E2f7 UTSW 10 110,610,656 (GRCm39) nonsense probably null
R2108:E2f7 UTSW 10 110,616,763 (GRCm39) missense probably benign 0.20
R2259:E2f7 UTSW 10 110,582,204 (GRCm39) missense probably damaging 0.99
R3408:E2f7 UTSW 10 110,620,578 (GRCm39) missense possibly damaging 0.57
R4356:E2f7 UTSW 10 110,595,712 (GRCm39) missense probably damaging 0.98
R4542:E2f7 UTSW 10 110,602,984 (GRCm39) missense probably damaging 1.00
R4763:E2f7 UTSW 10 110,616,710 (GRCm39) missense probably damaging 0.97
R5236:E2f7 UTSW 10 110,603,070 (GRCm39) missense probably damaging 1.00
R5520:E2f7 UTSW 10 110,595,806 (GRCm39) missense probably damaging 1.00
R6481:E2f7 UTSW 10 110,610,542 (GRCm39) missense probably damaging 1.00
R7253:E2f7 UTSW 10 110,602,164 (GRCm39) splice site probably null
R7320:E2f7 UTSW 10 110,599,991 (GRCm39) missense not run
R7348:E2f7 UTSW 10 110,616,836 (GRCm39) missense probably damaging 0.98
R8219:E2f7 UTSW 10 110,595,704 (GRCm39) missense probably damaging 1.00
R8530:E2f7 UTSW 10 110,614,859 (GRCm39) missense probably benign 0.31
R8887:E2f7 UTSW 10 110,610,674 (GRCm39) missense probably benign 0.02
R8958:E2f7 UTSW 10 110,601,615 (GRCm39) missense probably damaging 0.98
R9092:E2f7 UTSW 10 110,616,874 (GRCm39) missense probably benign 0.01
R9192:E2f7 UTSW 10 110,599,851 (GRCm39) missense probably damaging 1.00
R9454:E2f7 UTSW 10 110,620,542 (GRCm39) missense probably benign 0.00
R9474:E2f7 UTSW 10 110,614,918 (GRCm39) missense probably damaging 0.99
R9474:E2f7 UTSW 10 110,603,050 (GRCm39) missense probably damaging 1.00
R9538:E2f7 UTSW 10 110,616,628 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GAAATGCTGACCGTGCAGTTTTG -3'
(R):5'- GGACAAGCCGAAGTTCATGG -3'

Sequencing Primer
(F):5'- GCCGCCTGTGTGATGTAAC -3'
(R):5'- AAGCCGAAGTTCATGGGTCCG -3'
Posted On 2022-02-07