Mutagenetix > Incidental Mutation

Incidental Mutation 'R9166:Ap3b1'

696088

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R9166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 94471728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 569 (Y569S)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022196
AA Change: Y569S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: Y569S

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000231916

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,171,048		probably null	Het
4932438A13Rik	T	A	3: 36,987,367	N2630K	probably damaging	Het
4932438H23Rik	A	G	16: 91,056,158	L30P	possibly damaging	Het
Adgrb1	A	C	15: 74,548,626	M875L	probably benign	Het
Amot	A	T	X: 145,461,749	L435H		Het
Ankrd13c	T	A	3: 157,999,720	S427T	probably benign	Het
Bco2	A	G	9: 50,536,367	V352A	probably benign	Het
Cacnb1	T	A	11: 98,019,708	D48V	probably damaging	Het
Cdr2l	C	A	11: 115,392,711	Q132K	probably benign	Het
Chrd	T	C	16: 20,735,822	M377T	probably benign	Het
Coq7	T	C	7: 118,510,142	T228A	unknown	Het
D7Ertd443e	G	A	7: 134,298,319	T438I	probably benign	Het
Dlc1	C	T	8: 36,599,435	E15K	probably damaging	Het
Dlgap5	C	T	14: 47,413,749	R109Q	probably damaging	Het
Dysf	T	C	6: 84,149,977	V1359A	probably damaging	Het
E2f7	C	T	10: 110,782,224	P717S	probably benign	Het
Elmo2	T	C	2: 165,290,518	D669G	probably benign	Het
Epha6	A	G	16: 60,604,875	V125A	probably benign	Het
Erg	G	T	16: 95,389,948	H119N	probably benign	Het
Fam13b	T	C	18: 34,462,199	S371G	probably benign	Het
Fancg	G	C	4: 43,006,800	Q297E	probably benign	Het
Gas2	A	G	7: 51,936,575	E145G	possibly damaging	Het
Gas7	T	C	11: 67,670,620	V218A	probably benign	Het
Gm9833	A	G	3: 10,088,789	N206S	probably benign	Het
Gm9970	A	G	5: 31,241,001	S78P	unknown	Het
Hectd4	A	C	5: 121,308,627	D259A	probably damaging	Het
Hoxb2	T	G	11: 96,353,513	S317A	probably damaging	Het
Hspg2	T	C	4: 137,542,874	L2381P	probably damaging	Het
Irf4	A	T	13: 30,757,501	H280L	probably benign	Het
Irf7	A	G	7: 141,264,753	V142A	probably benign	Het
Kat7	T	C	11: 95,300,102	I94V	probably benign	Het
Kera	T	A	10: 97,612,968	I350K	possibly damaging	Het
Klf15	T	C	6: 90,466,970	S176P	probably benign	Het
Lrrc59	C	A	11: 94,632,133	T53N	probably benign	Het
Morn5	T	C	2: 36,055,012	Y83H	probably damaging	Het
Neil3	A	C	8: 53,605,687	M273R	probably damaging	Het
Ngfr	A	T	11: 95,574,221	V267E	possibly damaging	Het
Nudc	T	C	4: 133,545,854	D11G	probably damaging	Het
Olfr1254	T	A	2: 89,788,947	N135I	probably damaging	Het
Olfr31	A	T	14: 14,329,059	D316V	probably benign	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pik3cg	C	T	12: 32,192,214	G966R	probably damaging	Het
Ppfibp1	A	G	6: 147,019,482	T573A	probably damaging	Het
Ppp2r5a	C	A	1: 191,396,307	R37L	probably benign	Het
Prpf8	T	C	11: 75,496,514	F1207S	possibly damaging	Het
Prtg	A	T	9: 72,856,825	I527F	probably damaging	Het
Pspc1	A	G	14: 56,761,848	M317T	probably damaging	Het
Ptpru	C	T	4: 131,797,869	V768I	probably benign	Het
Ptx4	A	G	17: 25,124,572		probably null	Het
Ralgapb	T	C	2: 158,432,922		probably null	Het
Rhobtb2	C	A	14: 69,797,254	G174V	probably damaging	Het
Sdad1	G	T	5: 92,298,221	S285*	probably null	Het
Sema4f	G	T	6: 82,913,645	S727*	probably null	Het
Sik1	A	G	17: 31,850,753	F241L	probably damaging	Het
Slc8b1	T	C	5: 120,524,031	S279P	probably benign	Het
Slco4a1	A	G	2: 180,464,241	E72G	probably benign	Het
Smok3c	A	T	5: 138,065,519	T423S	possibly damaging	Het
Sorcs3	T	C	19: 48,796,372	V1078A	probably benign	Het
Sptb	A	G	12: 76,627,002	V337A	probably damaging	Het
Tet2	C	A	3: 133,468,172	G1443V	probably damaging	Het
Ticam2	A	T	18: 46,560,981	L13H	probably damaging	Het
Tnrc6a	A	G	7: 123,187,401	E1562G	probably damaging	Het
Trim24	A	T	6: 37,957,139	K742N	probably damaging	Het
Trim56	A	T	5: 137,113,897	V255E	probably damaging	Het
Trmt12	A	G	15: 58,872,759	E2G	probably benign	Het
Tubd1	A	T	11: 86,561,265	T353S	probably benign	Het
Vim	T	C	2: 13,574,745	V105A	probably benign	Het
Vmn2r58	A	T	7: 41,864,007	V404E	probably damaging	Het
Wdr62	G	A	7: 30,242,449	P1115L	probably damaging	Het
Wfdc12	G	T	2: 164,190,273	C32*	probably null	Het
Zfp750	T	A	11: 121,513,154	R298S	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCATGGAACGACATTTGTTTG -3'
(R):5'- GTTTCTCAGAGGGAAGCCTG -3'

Sequencing Primer
(F):5'- GGAACGACATTTGTTTGACATAACC -3'
(R):5'- ACACTGACACGCTGTAGGCAG -3'

Posted On

2022-02-07