Incidental Mutation 'R9166:Fam13b'
ID 696101
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R9166 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34462199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 371 (S371G)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect probably benign
Transcript: ENSMUST00000040506
AA Change: S371G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: S371G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,171,048 probably null Het
4932438A13Rik T A 3: 36,987,367 N2630K probably damaging Het
4932438H23Rik A G 16: 91,056,158 L30P possibly damaging Het
Adgrb1 A C 15: 74,548,626 M875L probably benign Het
Amot A T X: 145,461,749 L435H Het
Ankrd13c T A 3: 157,999,720 S427T probably benign Het
Ap3b1 A C 13: 94,471,728 Y569S probably damaging Het
Bco2 A G 9: 50,536,367 V352A probably benign Het
Cacnb1 T A 11: 98,019,708 D48V probably damaging Het
Cdr2l C A 11: 115,392,711 Q132K probably benign Het
Chrd T C 16: 20,735,822 M377T probably benign Het
Coq7 T C 7: 118,510,142 T228A unknown Het
D7Ertd443e G A 7: 134,298,319 T438I probably benign Het
Dlc1 C T 8: 36,599,435 E15K probably damaging Het
Dlgap5 C T 14: 47,413,749 R109Q probably damaging Het
Dysf T C 6: 84,149,977 V1359A probably damaging Het
E2f7 C T 10: 110,782,224 P717S probably benign Het
Elmo2 T C 2: 165,290,518 D669G probably benign Het
Epha6 A G 16: 60,604,875 V125A probably benign Het
Erg G T 16: 95,389,948 H119N probably benign Het
Fancg G C 4: 43,006,800 Q297E probably benign Het
Gas2 A G 7: 51,936,575 E145G possibly damaging Het
Gas7 T C 11: 67,670,620 V218A probably benign Het
Gm9833 A G 3: 10,088,789 N206S probably benign Het
Gm9970 A G 5: 31,241,001 S78P unknown Het
Hectd4 A C 5: 121,308,627 D259A probably damaging Het
Hoxb2 T G 11: 96,353,513 S317A probably damaging Het
Hspg2 T C 4: 137,542,874 L2381P probably damaging Het
Irf4 A T 13: 30,757,501 H280L probably benign Het
Irf7 A G 7: 141,264,753 V142A probably benign Het
Kat7 T C 11: 95,300,102 I94V probably benign Het
Kera T A 10: 97,612,968 I350K possibly damaging Het
Klf15 T C 6: 90,466,970 S176P probably benign Het
Lrrc59 C A 11: 94,632,133 T53N probably benign Het
Morn5 T C 2: 36,055,012 Y83H probably damaging Het
Neil3 A C 8: 53,605,687 M273R probably damaging Het
Ngfr A T 11: 95,574,221 V267E possibly damaging Het
Nudc T C 4: 133,545,854 D11G probably damaging Het
Olfr1254 T A 2: 89,788,947 N135I probably damaging Het
Olfr31 A T 14: 14,329,059 D316V probably benign Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pik3cg C T 12: 32,192,214 G966R probably damaging Het
Ppfibp1 A G 6: 147,019,482 T573A probably damaging Het
Ppp2r5a C A 1: 191,396,307 R37L probably benign Het
Prpf8 T C 11: 75,496,514 F1207S possibly damaging Het
Prtg A T 9: 72,856,825 I527F probably damaging Het
Pspc1 A G 14: 56,761,848 M317T probably damaging Het
Ptpru C T 4: 131,797,869 V768I probably benign Het
Ptx4 A G 17: 25,124,572 probably null Het
Ralgapb T C 2: 158,432,922 probably null Het
Rhobtb2 C A 14: 69,797,254 G174V probably damaging Het
Sdad1 G T 5: 92,298,221 S285* probably null Het
Sema4f G T 6: 82,913,645 S727* probably null Het
Sik1 A G 17: 31,850,753 F241L probably damaging Het
Slc8b1 T C 5: 120,524,031 S279P probably benign Het
Slco4a1 A G 2: 180,464,241 E72G probably benign Het
Smok3c A T 5: 138,065,519 T423S possibly damaging Het
Sorcs3 T C 19: 48,796,372 V1078A probably benign Het
Sptb A G 12: 76,627,002 V337A probably damaging Het
Tet2 C A 3: 133,468,172 G1443V probably damaging Het
Ticam2 A T 18: 46,560,981 L13H probably damaging Het
Tnrc6a A G 7: 123,187,401 E1562G probably damaging Het
Trim24 A T 6: 37,957,139 K742N probably damaging Het
Trim56 A T 5: 137,113,897 V255E probably damaging Het
Trmt12 A G 15: 58,872,759 E2G probably benign Het
Tubd1 A T 11: 86,561,265 T353S probably benign Het
Vim T C 2: 13,574,745 V105A probably benign Het
Vmn2r58 A T 7: 41,864,007 V404E probably damaging Het
Wdr62 G A 7: 30,242,449 P1115L probably damaging Het
Wfdc12 G T 2: 164,190,273 C32* probably null Het
Zfp750 T A 11: 121,513,154 R298S probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGTATTTAGGGAATTAACATGCTTG -3'
(R):5'- GAAAGTTCTTTCCTATATTTGAGACCT -3'

Sequencing Primer
(F):5'- CTTGAACACCAACACTCTG -3'
(R):5'- GCCTCCTTGAGAATTAGGCAG -3'
Posted On 2022-02-07