Incidental Mutation 'R9167:Nlrp4e'
ID 696127
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9167 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23340526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 758 (N758S)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: N758S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: N758S

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,011,126 V815F possibly damaging Het
Abcb4 T A 5: 8,936,849 L756* probably null Het
Acrbp T C 6: 125,062,979 L515P probably damaging Het
Amot A T X: 145,461,749 L435H Het
Atic T A 1: 71,564,881 I201N probably benign Het
Avpr1b T C 1: 131,609,413 S312P probably damaging Het
Cables1 T C 18: 11,905,972 V314A possibly damaging Het
Cd22 G A 7: 30,876,005 T204I probably benign Het
Cep250 A G 2: 155,987,000 N95D Het
Ctla4 C T 1: 60,912,536 R75W probably damaging Het
Cul7 A G 17: 46,655,697 M649V probably benign Het
Ddx46 T A 13: 55,655,102 V479E probably null Het
Dnah7a T C 1: 53,618,211 N802S probably benign Het
Fam208b A G 13: 3,574,724 V1742A probably benign Het
Fmn2 G T 1: 174,503,490 R482L unknown Het
Fyn T G 10: 39,526,815 D194E probably benign Het
Hdac4 G A 1: 91,947,534 T905M probably benign Het
Herc1 A G 9: 66,504,618 I4707V possibly damaging Het
Hmgcs2 T C 3: 98,297,114 I277T possibly damaging Het
Kcnj15 A G 16: 95,295,882 D121G probably damaging Het
Kcnt2 A G 1: 140,578,462 E899G probably benign Het
Kif16b A T 2: 142,700,920 L152* probably null Het
Krt73 A G 15: 101,793,970 V486A probably benign Het
Lrrc37a T A 11: 103,456,832 K3012N unknown Het
Musk A T 4: 58,296,687 I96F probably benign Het
Myrfl A G 10: 116,831,545 V330A probably damaging Het
Nanp A T 2: 151,030,808 C67S probably benign Het
Nrxn3 T A 12: 89,187,298 V345D probably damaging Het
Nsun7 G A 5: 66,278,651 V289I possibly damaging Het
Olfr646 A G 7: 104,107,219 *313W probably null Het
Pde4a T C 9: 21,191,502 S161P probably benign Het
Pom121l2 C T 13: 21,982,990 A477V probably damaging Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Ryr3 A T 2: 112,834,053 I1651N probably damaging Het
Serpinb6e A G 13: 33,839,026 F125L possibly damaging Het
Slc2a9 T A 5: 38,391,749 T341S probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tlx2 T A 6: 83,069,061 K211* probably null Het
Tmem266 A G 9: 55,414,947 D174G probably damaging Het
Tpm3 T A 3: 90,087,517 I147N probably benign Het
Unc93a T C 17: 13,116,221 K313E possibly damaging Het
Vmn1r9 A C 6: 57,071,153 E71A probably benign Het
Vwa2 T A 19: 56,910,631 D754E probably benign Het
Zfp677 T C 17: 21,393,198 V18A probably damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9181:Nlrp4e UTSW 7 23361845 nonsense probably null
R9219:Nlrp4e UTSW 7 23321516 missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23321374 missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9380:Nlrp4e UTSW 7 23321330 missense probably benign
R9448:Nlrp4e UTSW 7 23301531 missense probably benign
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AACCTTCATGGGAATAGCAAGG -3'
(R):5'- GATCCTTGAGCTCTAAGACCC -3'

Sequencing Primer
(F):5'- TTCATGGGAATAGCAAGGAAAAATTG -3'
(R):5'- CAGCTCTGTGGTTGCAGACATC -3'
Posted On 2022-02-07