Incidental Mutation 'R9167:Krt73'
ID 696142
Institutional Source Beutler Lab
Gene Symbol Krt73
Ensembl Gene ENSMUSG00000063661
Gene Name keratin 73
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R9167 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101793308-101802346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101793970 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000065349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063292]
AlphaFold Q6NXH9
Predicted Effect probably benign
Transcript: ENSMUST00000063292
AA Change: V486A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: V486A

DomainStartEndE-ValueType
low complexity region 17 57 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.4e-19 PFAM
Filament 130 443 5.39e-159 SMART
low complexity region 450 461 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,011,126 V815F possibly damaging Het
Abcb4 T A 5: 8,936,849 L756* probably null Het
Acrbp T C 6: 125,062,979 L515P probably damaging Het
Amot A T X: 145,461,749 L435H Het
Atic T A 1: 71,564,881 I201N probably benign Het
Avpr1b T C 1: 131,609,413 S312P probably damaging Het
Cables1 T C 18: 11,905,972 V314A possibly damaging Het
Cd22 G A 7: 30,876,005 T204I probably benign Het
Cep250 A G 2: 155,987,000 N95D Het
Ctla4 C T 1: 60,912,536 R75W probably damaging Het
Cul7 A G 17: 46,655,697 M649V probably benign Het
Ddx46 T A 13: 55,655,102 V479E probably null Het
Dnah7a T C 1: 53,618,211 N802S probably benign Het
Fam208b A G 13: 3,574,724 V1742A probably benign Het
Fmn2 G T 1: 174,503,490 R482L unknown Het
Fyn T G 10: 39,526,815 D194E probably benign Het
Hdac4 G A 1: 91,947,534 T905M probably benign Het
Herc1 A G 9: 66,504,618 I4707V possibly damaging Het
Hmgcs2 T C 3: 98,297,114 I277T possibly damaging Het
Kcnj15 A G 16: 95,295,882 D121G probably damaging Het
Kcnt2 A G 1: 140,578,462 E899G probably benign Het
Kif16b A T 2: 142,700,920 L152* probably null Het
Lrrc37a T A 11: 103,456,832 K3012N unknown Het
Musk A T 4: 58,296,687 I96F probably benign Het
Myrfl A G 10: 116,831,545 V330A probably damaging Het
Nanp A T 2: 151,030,808 C67S probably benign Het
Nlrp4e A G 7: 23,340,526 N758S probably benign Het
Nrxn3 T A 12: 89,187,298 V345D probably damaging Het
Nsun7 G A 5: 66,278,651 V289I possibly damaging Het
Olfr646 A G 7: 104,107,219 *313W probably null Het
Pde4a T C 9: 21,191,502 S161P probably benign Het
Pom121l2 C T 13: 21,982,990 A477V probably damaging Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Ryr3 A T 2: 112,834,053 I1651N probably damaging Het
Serpinb6e A G 13: 33,839,026 F125L possibly damaging Het
Slc2a9 T A 5: 38,391,749 T341S probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tlx2 T A 6: 83,069,061 K211* probably null Het
Tmem266 A G 9: 55,414,947 D174G probably damaging Het
Tpm3 T A 3: 90,087,517 I147N probably benign Het
Unc93a T C 17: 13,116,221 K313E possibly damaging Het
Vmn1r9 A C 6: 57,071,153 E71A probably benign Het
Vwa2 T A 19: 56,910,631 D754E probably benign Het
Zfp677 T C 17: 21,393,198 V18A probably damaging Het
Other mutations in Krt73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Krt73 APN 15 101798937 critical splice acceptor site probably null
IGL01768:Krt73 APN 15 101798856 missense probably benign 0.01
IGL01836:Krt73 APN 15 101795896 missense probably benign 0.38
IGL02058:Krt73 APN 15 101802021 missense probably benign
IGL02063:Krt73 APN 15 101795769 splice site probably benign
IGL02076:Krt73 APN 15 101799935 missense probably damaging 1.00
IGL02878:Krt73 APN 15 101798826 missense probably damaging 1.00
IGL03127:Krt73 APN 15 101795840 missense probably benign
R0032:Krt73 UTSW 15 101794052 missense probably benign 0.30
R0109:Krt73 UTSW 15 101796395 nonsense probably null
R0143:Krt73 UTSW 15 101800773 missense probably damaging 1.00
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0254:Krt73 UTSW 15 101799889 splice site probably benign
R0256:Krt73 UTSW 15 101801936 missense probably damaging 1.00
R0497:Krt73 UTSW 15 101802230 missense probably damaging 0.99
R1592:Krt73 UTSW 15 101802239 nonsense probably null
R1681:Krt73 UTSW 15 101802047 missense possibly damaging 0.70
R1696:Krt73 UTSW 15 101799909 missense probably damaging 1.00
R1766:Krt73 UTSW 15 101793928 missense probably damaging 1.00
R2031:Krt73 UTSW 15 101798764 splice site probably benign
R2171:Krt73 UTSW 15 101800910 missense possibly damaging 0.88
R4674:Krt73 UTSW 15 101802075 missense probably benign 0.22
R4777:Krt73 UTSW 15 101794001 missense probably benign
R4869:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R4892:Krt73 UTSW 15 101795809 missense probably damaging 0.99
R5794:Krt73 UTSW 15 101794829 missense probably benign 0.00
R6807:Krt73 UTSW 15 101796407 missense probably damaging 1.00
R6885:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R7489:Krt73 UTSW 15 101793859 missense probably benign 0.00
R7682:Krt73 UTSW 15 101802045 missense probably benign 0.08
R9795:Krt73 UTSW 15 101802290 missense probably damaging 1.00
Z1177:Krt73 UTSW 15 101793811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTTCCTGGAAGAGAGTCC -3'
(R):5'- TCATTGGATGCTGGAAGGGAC -3'

Sequencing Primer
(F):5'- CCAAAGCTCGGCAGAAATG -3'
(R):5'- ACTTGGGGCCACGTCTAC -3'
Posted On 2022-02-07