Incidental Mutation 'R9168:Slc6a13'
ID 696178
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R9168 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121302042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 208 (L208P)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: L208P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: L208P

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142419
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alppl2 T C 1: 87,015,050 (GRCm39) Y437C probably damaging Het
Arhgef11 T G 3: 87,633,790 (GRCm39) L808R probably damaging Het
Armc7 G A 11: 115,366,724 (GRCm39) probably benign Het
Ascl1 T C 10: 87,328,361 (GRCm39) N197S probably benign Het
Cdc42bpb T G 12: 111,286,517 (GRCm39) E630D possibly damaging Het
Cep128 T C 12: 91,233,794 (GRCm39) I425V probably damaging Het
Ces4a T A 8: 105,876,050 (GRCm39) D530E probably benign Het
Ch25h T C 19: 34,451,905 (GRCm39) I208V probably benign Het
Cnpy3 A C 17: 47,063,019 (GRCm39) C11G unknown Het
Col12a1 A C 9: 79,548,783 (GRCm39) Y2187* probably null Het
Cyp2c40 C T 19: 39,755,819 (GRCm39) M498I probably benign Het
D630039A03Rik T A 4: 57,910,113 (GRCm39) Y233F probably damaging Het
Dffa A T 4: 149,192,226 (GRCm39) D100V probably damaging Het
Dock7 A T 4: 98,953,643 (GRCm39) M363K Het
Dscam A G 16: 96,420,768 (GRCm39) V1706A possibly damaging Het
En1 A G 1: 120,530,892 (GRCm39) D44G unknown Het
Enpp4 T A 17: 44,413,141 (GRCm39) N131I probably damaging Het
Ezh1 T C 11: 101,086,433 (GRCm39) D587G probably damaging Het
Gm21149 G T 5: 15,677,132 (GRCm39) H241N possibly damaging Het
Gna15 T C 10: 81,350,192 (GRCm39) Y70C probably damaging Het
Gucy1a1 T G 3: 82,009,353 (GRCm39) M552L probably damaging Het
Herc2 G A 7: 55,802,208 (GRCm39) V2017M probably damaging Het
Hsf4 C T 8: 105,999,373 (GRCm39) A297V probably benign Het
Ighd T A 12: 113,379,203 (GRCm39) T122S Het
Iqca1 C T 1: 90,065,937 (GRCm39) R218Q probably damaging Het
Isl2 C A 9: 55,452,227 (GRCm39) S266R probably benign Het
Itpkb A C 1: 180,160,028 (GRCm39) R51S probably benign Het
Jup A T 11: 100,274,219 (GRCm39) probably null Het
Kbtbd6 T C 14: 79,690,553 (GRCm39) V416A possibly damaging Het
Klhl22 T A 16: 17,602,068 (GRCm39) Y372N probably damaging Het
Klrc3 T C 6: 129,616,142 (GRCm39) E191G probably damaging Het
Lhx5 A G 5: 120,570,410 (GRCm39) D22G probably benign Het
Marchf9 GGGCGGCGGCGGCGGCG GGGCGGCGGCGGCG 10: 126,895,360 (GRCm39) probably benign Het
Mbtps1 A G 8: 120,248,602 (GRCm39) I707T probably benign Het
Nbeal1 T A 1: 60,331,047 (GRCm39) Y2219N probably damaging Het
Neb A G 2: 52,085,696 (GRCm39) I5513T probably damaging Het
Nkx1-1 C T 5: 33,591,131 (GRCm39) V64M unknown Het
Nme4 G T 17: 26,314,389 (GRCm39) A13E probably benign Het
Or2g25 T C 17: 37,971,047 (GRCm39) Y59C probably damaging Het
Or52e18 A G 7: 104,609,001 (GRCm39) *313R probably null Het
Or7e173 T C 9: 19,938,818 (GRCm39) M139V probably benign Het
Osbpl3 A T 6: 50,329,762 (GRCm39) probably null Het
Phc3 T A 3: 30,961,544 (GRCm39) M963L probably benign Het
Phf20 C T 2: 156,109,234 (GRCm39) P194S probably benign Het
Pou1f1 C T 16: 65,317,427 (GRCm39) probably benign Het
Pramel46 T A 5: 95,418,133 (GRCm39) M288L probably benign Het
Prdm13 C G 4: 21,679,659 (GRCm39) R277P unknown Het
Prelid1 A G 13: 55,470,010 (GRCm39) K3R possibly damaging Het
Psd C A 19: 46,309,233 (GRCm39) D575Y probably damaging Het
Ptger3 C A 3: 157,273,424 (GRCm39) T257K probably damaging Het
Pth1r T C 9: 110,556,204 (GRCm39) H223R probably benign Het
Ptk2b C T 14: 66,424,899 (GRCm39) E182K probably damaging Het
Ptprj T C 2: 90,294,916 (GRCm39) T431A possibly damaging Het
Rbbp5 T A 1: 132,417,464 (GRCm39) D119E probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,429,651 (GRCm39) probably benign Het
Rinl T G 7: 28,490,084 (GRCm39) L41R possibly damaging Het
Rrp12 A G 19: 41,865,603 (GRCm39) V730A probably benign Het
Saraf G T 8: 34,632,343 (GRCm39) V141L possibly damaging Het
Slc9a9 C A 9: 94,595,000 (GRCm39) T170K probably damaging Het
Spata31f1e T C 4: 42,793,380 (GRCm39) T251A probably benign Het
Stk33 T C 7: 108,928,747 (GRCm39) N255S probably damaging Het
Tenm2 C T 11: 35,930,722 (GRCm39) V1769M probably damaging Het
Themis C A 10: 28,658,233 (GRCm39) T420N probably benign Het
Tmem116 T C 5: 121,605,975 (GRCm39) V109A Het
Tnfaip2 T A 12: 111,411,382 (GRCm39) L2Q probably damaging Het
Trub1 T C 19: 57,452,859 (GRCm39) probably null Het
Ttn C T 2: 76,679,260 (GRCm39) V10821I unknown Het
Ube2j1 C A 4: 33,045,111 (GRCm39) A197D probably benign Het
Vmn2r101 T A 17: 19,809,138 (GRCm39) I89N probably damaging Het
Wfikkn1 T C 17: 26,097,145 (GRCm39) Y393C probably damaging Het
Zfp729b C A 13: 67,741,942 (GRCm39) E108* probably null Het
Zfp976 A T 7: 42,263,011 (GRCm39) C276* probably null Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TAGCAACGTTCATAGCCCTGG -3'
(R):5'- CATTCAGGAAGGAAGCCACATG -3'

Sequencing Primer
(F):5'- AACGTTCATAGCCCTGGGTTCTAAC -3'
(R):5'- TCAGGAAGGAAGCCACATGAACTC -3'
Posted On 2022-02-07