Incidental Mutation 'R9168:Pth1r'
ID 696194
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9168 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110722085-110747145 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110727136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 223 (H223R)
Ref Sequence ENSEMBL: ENSMUSP00000006005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect probably benign
Transcript: ENSMUST00000006005
AA Change: H223R

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492
AA Change: H223R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166716
AA Change: H223R

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492
AA Change: H223R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198865
AA Change: H223R

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492
AA Change: H223R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alppl2 T C 1: 87,087,328 Y437C probably damaging Het
Arhgef11 T G 3: 87,726,483 L808R probably damaging Het
Armc7 G A 11: 115,475,898 probably benign Het
Ascl1 T C 10: 87,492,499 N197S probably benign Het
Cdc42bpb T G 12: 111,320,083 E630D possibly damaging Het
Cep128 T C 12: 91,267,020 I425V probably damaging Het
Ces4a T A 8: 105,149,418 D530E probably benign Het
Ch25h T C 19: 34,474,505 I208V probably benign Het
Cnpy3 A C 17: 46,752,093 C11G unknown Het
Col12a1 A C 9: 79,641,501 Y2187* probably null Het
Cyp2c40 C T 19: 39,767,375 M498I probably benign Het
D630039A03Rik T A 4: 57,910,113 Y233F probably damaging Het
Dffa A T 4: 149,107,769 D100V probably damaging Het
Dock7 A T 4: 99,065,406 M363K Het
Dscam A G 16: 96,619,568 V1706A possibly damaging Het
En1 A G 1: 120,603,163 D44G unknown Het
Enpp4 T A 17: 44,102,250 N131I probably damaging Het
Ezh1 T C 11: 101,195,607 D587G probably damaging Het
Gm10424 T A 5: 95,270,274 M288L probably benign Het
Gm12394 T C 4: 42,793,380 T251A probably benign Het
Gm21149 G T 5: 15,472,134 H241N possibly damaging Het
Gna15 T C 10: 81,514,358 Y70C probably damaging Het
Gucy1a1 T G 3: 82,102,046 M552L probably damaging Het
Herc2 G A 7: 56,152,460 V2017M probably damaging Het
Hsf4 C T 8: 105,272,741 A297V probably benign Het
Ighd T A 12: 113,415,583 T122S Het
Iqca C T 1: 90,138,215 R218Q probably damaging Het
Isl2 C A 9: 55,544,943 S266R probably benign Het
Itpkb A C 1: 180,332,463 R51S probably benign Het
Jup A T 11: 100,383,393 probably null Het
Kbtbd6 T C 14: 79,453,113 V416A possibly damaging Het
Klhl22 T A 16: 17,784,204 Y372N probably damaging Het
Klrc3 T C 6: 129,639,179 E191G probably damaging Het
Lhx5 A G 5: 120,432,345 D22G probably benign Het
March9 GGGCGGCGGCGGCGGCG GGGCGGCGGCGGCG 10: 127,059,491 probably benign Het
Mbtps1 A G 8: 119,521,863 I707T probably benign Het
Nbeal1 T A 1: 60,291,888 Y2219N probably damaging Het
Neb A G 2: 52,195,684 I5513T probably damaging Het
Nkx1-1 C T 5: 33,433,787 V64M unknown Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr117 T C 17: 37,660,156 Y59C probably damaging Het
Olfr670 A G 7: 104,959,794 *313R probably null Het
Olfr866 T C 9: 20,027,522 M139V probably benign Het
Osbpl3 A T 6: 50,352,782 probably null Het
Phc3 T A 3: 30,907,395 M963L probably benign Het
Phf20 C T 2: 156,267,314 P194S probably benign Het
Pou1f1 C T 16: 65,520,541 probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prelid1 A G 13: 55,322,197 K3R possibly damaging Het
Psd C A 19: 46,320,794 D575Y probably damaging Het
Ptger3 C A 3: 157,567,787 T257K probably damaging Het
Ptk2b C T 14: 66,187,450 E182K probably damaging Het
Ptprj T C 2: 90,464,572 T431A possibly damaging Het
Rbbp5 T A 1: 132,489,726 D119E probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Rest GGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGG GGCCTGCCCCTCCCACGG 5: 77,281,843 probably benign Het
Rinl T G 7: 28,790,659 L41R possibly damaging Het
Rrp12 A G 19: 41,877,164 V730A probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Saraf G T 8: 34,165,189 V141L possibly damaging Het
Slc6a13 T C 6: 121,325,083 L208P probably damaging Het
Slc9a9 C A 9: 94,712,947 T170K probably damaging Het
Stk33 T C 7: 109,329,540 N255S probably damaging Het
Tenm2 C T 11: 36,039,895 V1769M probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tmem116 T C 5: 121,467,912 V109A Het
Tnfaip2 T A 12: 111,444,948 L2Q probably damaging Het
Trub1 T C 19: 57,464,427 probably null Het
Ttn C T 2: 76,848,916 V10821I unknown Het
Ube2j1 C A 4: 33,045,111 A197D probably benign Het
Vmn2r101 T A 17: 19,588,876 I89N probably damaging Het
Wfikkn1 T C 17: 25,878,171 Y393C probably damaging Het
Zfp729b C A 13: 67,593,823 E108* probably null Het
Zfp976 A T 7: 42,613,587 C276* probably null Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R2206:Pth1r UTSW 9 110723587 missense probably damaging 1.00
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4590:Pth1r UTSW 9 110722271 missense probably benign 0.04
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110727251 splice site probably null
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6914:Pth1r UTSW 9 110728016 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R8966:Pth1r UTSW 9 110725161 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTTTGCTGGCCTAAAGCTG -3'
(R):5'- CCTAGCCTATTTTAGGTGGGCG -3'

Sequencing Primer
(F):5'- TAGGCTGCAGGTGCGAG -3'
(R):5'- TGCATCTGGAGGGGTCC -3'
Posted On 2022-02-07