Incidental Mutation 'R9168:Tenm2'
ID 696199
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms D3Bwg1534e, Odz2, 9330187F13Rik, Ten-m2, 2610040L17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R9168 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 35897483-37126791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35930722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1769 (V1769M)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: V1769M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: V1769M

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: V1768M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: V1768M

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: V1768M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: V1768M

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alppl2 T C 1: 87,015,050 (GRCm39) Y437C probably damaging Het
Arhgef11 T G 3: 87,633,790 (GRCm39) L808R probably damaging Het
Armc7 G A 11: 115,366,724 (GRCm39) probably benign Het
Ascl1 T C 10: 87,328,361 (GRCm39) N197S probably benign Het
Cdc42bpb T G 12: 111,286,517 (GRCm39) E630D possibly damaging Het
Cep128 T C 12: 91,233,794 (GRCm39) I425V probably damaging Het
Ces4a T A 8: 105,876,050 (GRCm39) D530E probably benign Het
Ch25h T C 19: 34,451,905 (GRCm39) I208V probably benign Het
Cnpy3 A C 17: 47,063,019 (GRCm39) C11G unknown Het
Col12a1 A C 9: 79,548,783 (GRCm39) Y2187* probably null Het
Cyp2c40 C T 19: 39,755,819 (GRCm39) M498I probably benign Het
D630039A03Rik T A 4: 57,910,113 (GRCm39) Y233F probably damaging Het
Dffa A T 4: 149,192,226 (GRCm39) D100V probably damaging Het
Dock7 A T 4: 98,953,643 (GRCm39) M363K Het
Dscam A G 16: 96,420,768 (GRCm39) V1706A possibly damaging Het
En1 A G 1: 120,530,892 (GRCm39) D44G unknown Het
Enpp4 T A 17: 44,413,141 (GRCm39) N131I probably damaging Het
Ezh1 T C 11: 101,086,433 (GRCm39) D587G probably damaging Het
Gm21149 G T 5: 15,677,132 (GRCm39) H241N possibly damaging Het
Gna15 T C 10: 81,350,192 (GRCm39) Y70C probably damaging Het
Gucy1a1 T G 3: 82,009,353 (GRCm39) M552L probably damaging Het
Herc2 G A 7: 55,802,208 (GRCm39) V2017M probably damaging Het
Hsf4 C T 8: 105,999,373 (GRCm39) A297V probably benign Het
Ighd T A 12: 113,379,203 (GRCm39) T122S Het
Iqca1 C T 1: 90,065,937 (GRCm39) R218Q probably damaging Het
Isl2 C A 9: 55,452,227 (GRCm39) S266R probably benign Het
Itpkb A C 1: 180,160,028 (GRCm39) R51S probably benign Het
Jup A T 11: 100,274,219 (GRCm39) probably null Het
Kbtbd6 T C 14: 79,690,553 (GRCm39) V416A possibly damaging Het
Klhl22 T A 16: 17,602,068 (GRCm39) Y372N probably damaging Het
Klrc3 T C 6: 129,616,142 (GRCm39) E191G probably damaging Het
Lhx5 A G 5: 120,570,410 (GRCm39) D22G probably benign Het
Marchf9 GGGCGGCGGCGGCGGCG GGGCGGCGGCGGCG 10: 126,895,360 (GRCm39) probably benign Het
Mbtps1 A G 8: 120,248,602 (GRCm39) I707T probably benign Het
Nbeal1 T A 1: 60,331,047 (GRCm39) Y2219N probably damaging Het
Neb A G 2: 52,085,696 (GRCm39) I5513T probably damaging Het
Nkx1-1 C T 5: 33,591,131 (GRCm39) V64M unknown Het
Nme4 G T 17: 26,314,389 (GRCm39) A13E probably benign Het
Or2g25 T C 17: 37,971,047 (GRCm39) Y59C probably damaging Het
Or52e18 A G 7: 104,609,001 (GRCm39) *313R probably null Het
Or7e173 T C 9: 19,938,818 (GRCm39) M139V probably benign Het
Osbpl3 A T 6: 50,329,762 (GRCm39) probably null Het
Phc3 T A 3: 30,961,544 (GRCm39) M963L probably benign Het
Phf20 C T 2: 156,109,234 (GRCm39) P194S probably benign Het
Pou1f1 C T 16: 65,317,427 (GRCm39) probably benign Het
Pramel46 T A 5: 95,418,133 (GRCm39) M288L probably benign Het
Prdm13 C G 4: 21,679,659 (GRCm39) R277P unknown Het
Prelid1 A G 13: 55,470,010 (GRCm39) K3R possibly damaging Het
Psd C A 19: 46,309,233 (GRCm39) D575Y probably damaging Het
Ptger3 C A 3: 157,273,424 (GRCm39) T257K probably damaging Het
Pth1r T C 9: 110,556,204 (GRCm39) H223R probably benign Het
Ptk2b C T 14: 66,424,899 (GRCm39) E182K probably damaging Het
Ptprj T C 2: 90,294,916 (GRCm39) T431A possibly damaging Het
Rbbp5 T A 1: 132,417,464 (GRCm39) D119E probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,429,651 (GRCm39) probably benign Het
Rinl T G 7: 28,490,084 (GRCm39) L41R possibly damaging Het
Rrp12 A G 19: 41,865,603 (GRCm39) V730A probably benign Het
Saraf G T 8: 34,632,343 (GRCm39) V141L possibly damaging Het
Slc6a13 T C 6: 121,302,042 (GRCm39) L208P probably damaging Het
Slc9a9 C A 9: 94,595,000 (GRCm39) T170K probably damaging Het
Spata31f1e T C 4: 42,793,380 (GRCm39) T251A probably benign Het
Stk33 T C 7: 108,928,747 (GRCm39) N255S probably damaging Het
Themis C A 10: 28,658,233 (GRCm39) T420N probably benign Het
Tmem116 T C 5: 121,605,975 (GRCm39) V109A Het
Tnfaip2 T A 12: 111,411,382 (GRCm39) L2Q probably damaging Het
Trub1 T C 19: 57,452,859 (GRCm39) probably null Het
Ttn C T 2: 76,679,260 (GRCm39) V10821I unknown Het
Ube2j1 C A 4: 33,045,111 (GRCm39) A197D probably benign Het
Vmn2r101 T A 17: 19,809,138 (GRCm39) I89N probably damaging Het
Wfikkn1 T C 17: 26,097,145 (GRCm39) Y393C probably damaging Het
Zfp729b C A 13: 67,741,942 (GRCm39) E108* probably null Het
Zfp976 A T 7: 42,263,011 (GRCm39) C276* probably null Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36,097,726 (GRCm39) splice site probably benign
IGL00834:Tenm2 APN 11 35,915,085 (GRCm39) missense probably damaging 1.00
IGL00911:Tenm2 APN 11 35,899,560 (GRCm39) nonsense probably null
IGL00937:Tenm2 APN 11 35,915,450 (GRCm39) missense probably damaging 1.00
IGL01154:Tenm2 APN 11 35,932,371 (GRCm39) missense probably damaging 1.00
IGL01313:Tenm2 APN 11 35,915,075 (GRCm39) missense probably damaging 0.98
IGL01346:Tenm2 APN 11 35,918,232 (GRCm39) nonsense probably null
IGL01539:Tenm2 APN 11 35,997,654 (GRCm39) missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36,755,711 (GRCm39) missense probably damaging 0.98
IGL01780:Tenm2 APN 11 35,937,768 (GRCm39) missense probably benign
IGL01821:Tenm2 APN 11 35,914,710 (GRCm39) missense probably damaging 0.98
IGL01988:Tenm2 APN 11 35,918,078 (GRCm39) missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36,097,922 (GRCm39) missense probably benign
IGL02449:Tenm2 APN 11 35,914,449 (GRCm39) missense probably damaging 0.99
IGL02505:Tenm2 APN 11 35,942,743 (GRCm39) nonsense probably null
IGL02649:Tenm2 APN 11 36,097,912 (GRCm39) missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 35,959,285 (GRCm39) missense probably benign 0.05
IGL02801:Tenm2 APN 11 35,937,857 (GRCm39) nonsense probably null
IGL02928:Tenm2 APN 11 35,917,997 (GRCm39) missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 35,932,471 (GRCm39) missense probably damaging 1.00
IGL03202:Tenm2 APN 11 35,915,375 (GRCm39) missense probably damaging 1.00
IGL03213:Tenm2 APN 11 35,914,157 (GRCm39) missense probably benign 0.05
IGL03276:Tenm2 APN 11 35,963,603 (GRCm39) missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 35,942,852 (GRCm39) splice site probably null
IGL03381:Tenm2 APN 11 35,959,238 (GRCm39) missense probably benign 0.01
IGL03398:Tenm2 APN 11 35,915,370 (GRCm39) missense probably damaging 1.00
browser UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
mosaic UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36,164,235 (GRCm39) missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 35,954,729 (GRCm39) missense probably damaging 0.99
R0004:Tenm2 UTSW 11 35,914,184 (GRCm39) missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36,097,951 (GRCm39) splice site probably benign
R0537:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
R0599:Tenm2 UTSW 11 35,915,607 (GRCm39) missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36,834,803 (GRCm39) missense probably damaging 1.00
R0693:Tenm2 UTSW 11 35,915,636 (GRCm39) missense probably damaging 1.00
R0991:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36,755,511 (GRCm39) missense probably benign 0.30
R1177:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 35,899,185 (GRCm39) missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 35,932,486 (GRCm39) missense probably damaging 1.00
R1272:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 35,959,421 (GRCm39) splice site probably benign
R1374:Tenm2 UTSW 11 35,899,281 (GRCm39) missense probably benign 0.00
R1542:Tenm2 UTSW 11 36,191,047 (GRCm39) missense probably damaging 0.99
R1573:Tenm2 UTSW 11 35,937,896 (GRCm39) missense probably damaging 1.00
R1579:Tenm2 UTSW 11 35,997,610 (GRCm39) missense probably damaging 1.00
R1697:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 35,898,930 (GRCm39) missense probably damaging 1.00
R1756:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 35,914,209 (GRCm39) missense probably damaging 0.99
R1950:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 35,938,374 (GRCm39) missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 35,938,091 (GRCm39) nonsense probably null
R2117:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36,755,689 (GRCm39) missense probably damaging 0.98
R2298:Tenm2 UTSW 11 35,937,604 (GRCm39) missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 35,918,018 (GRCm39) missense probably damaging 1.00
R3014:Tenm2 UTSW 11 35,914,800 (GRCm39) missense probably damaging 1.00
R3115:Tenm2 UTSW 11 35,914,193 (GRCm39) missense probably damaging 1.00
R3684:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3685:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3705:Tenm2 UTSW 11 35,959,153 (GRCm39) missense probably damaging 0.97
R3820:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3821:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3822:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3844:Tenm2 UTSW 11 35,938,365 (GRCm39) missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36,030,401 (GRCm39) critical splice donor site probably null
R4019:Tenm2 UTSW 11 35,937,901 (GRCm39) missense probably benign 0.04
R4062:Tenm2 UTSW 11 35,899,482 (GRCm39) missense probably damaging 1.00
R4367:Tenm2 UTSW 11 35,918,225 (GRCm39) missense probably benign
R4395:Tenm2 UTSW 11 35,915,451 (GRCm39) missense probably benign 0.23
R4508:Tenm2 UTSW 11 35,899,172 (GRCm39) missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 35,953,931 (GRCm39) missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 35,937,607 (GRCm39) missense probably damaging 1.00
R4644:Tenm2 UTSW 11 35,937,963 (GRCm39) missense probably benign 0.00
R4661:Tenm2 UTSW 11 35,915,275 (GRCm39) missense probably damaging 0.99
R4669:Tenm2 UTSW 11 35,901,314 (GRCm39) missense probably damaging 1.00
R4687:Tenm2 UTSW 11 35,939,924 (GRCm39) missense probably benign
R4711:Tenm2 UTSW 11 36,191,039 (GRCm39) missense probably damaging 0.98
R4816:Tenm2 UTSW 11 35,918,117 (GRCm39) missense probably damaging 1.00
R4843:Tenm2 UTSW 11 35,914,847 (GRCm39) missense probably damaging 1.00
R4850:Tenm2 UTSW 11 35,914,315 (GRCm39) nonsense probably null
R4870:Tenm2 UTSW 11 35,969,396 (GRCm39) missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36,097,907 (GRCm39) missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5073:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5074:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5081:Tenm2 UTSW 11 35,915,460 (GRCm39) missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36,834,989 (GRCm39) missense probably damaging 1.00
R5170:Tenm2 UTSW 11 35,915,633 (GRCm39) missense probably damaging 0.98
R5253:Tenm2 UTSW 11 35,938,028 (GRCm39) nonsense probably null
R5343:Tenm2 UTSW 11 35,960,330 (GRCm39) missense probably benign 0.00
R5493:Tenm2 UTSW 11 36,755,503 (GRCm39) missense probably benign 0.01
R5600:Tenm2 UTSW 11 36,054,541 (GRCm39) splice site probably null
R5677:Tenm2 UTSW 11 36,032,510 (GRCm39) missense probably damaging 0.98
R5703:Tenm2 UTSW 11 35,914,626 (GRCm39) missense probably benign 0.34
R5707:Tenm2 UTSW 11 35,938,009 (GRCm39) missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 35,963,556 (GRCm39) critical splice donor site probably null
R6063:Tenm2 UTSW 11 36,054,544 (GRCm39) critical splice donor site probably null
R6086:Tenm2 UTSW 11 35,899,473 (GRCm39) missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 35,899,610 (GRCm39) missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36,030,517 (GRCm39) missense probably damaging 0.99
R6193:Tenm2 UTSW 11 35,937,621 (GRCm39) missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36,755,686 (GRCm39) missense probably benign 0.44
R6477:Tenm2 UTSW 11 35,901,334 (GRCm39) critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
R6668:Tenm2 UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
R6825:Tenm2 UTSW 11 35,937,711 (GRCm39) missense probably benign 0.02
R6885:Tenm2 UTSW 11 35,914,407 (GRCm39) missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36,062,236 (GRCm39) missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36,054,644 (GRCm39) missense probably damaging 0.99
R7153:Tenm2 UTSW 11 35,915,009 (GRCm39) missense probably damaging 0.98
R7173:Tenm2 UTSW 11 35,932,378 (GRCm39) missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36,062,263 (GRCm39) missense probably damaging 1.00
R7205:Tenm2 UTSW 11 35,939,956 (GRCm39) missense probably damaging 0.99
R7250:Tenm2 UTSW 11 35,963,625 (GRCm39) missense probably damaging 1.00
R7290:Tenm2 UTSW 11 35,914,298 (GRCm39) missense probably damaging 1.00
R7366:Tenm2 UTSW 11 35,960,241 (GRCm39) missense probably benign 0.09
R7432:Tenm2 UTSW 11 36,755,768 (GRCm39) missense probably benign
R7504:Tenm2 UTSW 11 36,030,570 (GRCm39) missense probably damaging 1.00
R7513:Tenm2 UTSW 11 35,942,727 (GRCm39) missense probably benign 0.34
R7523:Tenm2 UTSW 11 35,969,408 (GRCm39) splice site probably null
R7527:Tenm2 UTSW 11 36,097,803 (GRCm39) missense probably damaging 1.00
R7648:Tenm2 UTSW 11 35,997,563 (GRCm39) missense probably damaging 1.00
R7653:Tenm2 UTSW 11 35,938,174 (GRCm39) missense probably benign 0.09
R7717:Tenm2 UTSW 11 36,755,762 (GRCm39) missense probably damaging 0.97
R7739:Tenm2 UTSW 11 35,960,388 (GRCm39) missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 35,914,133 (GRCm39) missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 35,901,276 (GRCm39) missense probably damaging 0.99
R7803:Tenm2 UTSW 11 35,937,943 (GRCm39) missense probably damaging 0.98
R7834:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R7838:Tenm2 UTSW 11 35,997,626 (GRCm39) missense probably benign 0.02
R8073:Tenm2 UTSW 11 36,030,471 (GRCm39) missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 35,918,048 (GRCm39) missense probably benign 0.23
R8109:Tenm2 UTSW 11 35,899,137 (GRCm39) missense probably benign
R8306:Tenm2 UTSW 11 35,960,196 (GRCm39) missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8452:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8864:Tenm2 UTSW 11 35,918,022 (GRCm39) missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 35,942,788 (GRCm39) missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36,834,861 (GRCm39) missense probably damaging 0.98
R8969:Tenm2 UTSW 11 35,942,688 (GRCm39) missense probably damaging 0.99
R9279:Tenm2 UTSW 11 35,959,303 (GRCm39) missense probably benign 0.00
R9294:Tenm2 UTSW 11 35,915,327 (GRCm39) missense probably damaging 0.98
R9320:Tenm2 UTSW 11 35,914,474 (GRCm39) missense probably damaging 0.99
R9373:Tenm2 UTSW 11 35,930,713 (GRCm39) missense probably damaging 1.00
R9408:Tenm2 UTSW 11 35,960,246 (GRCm39) missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36,032,396 (GRCm39) missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36,112,286 (GRCm39) missense probably benign
R9489:Tenm2 UTSW 11 36,834,791 (GRCm39) missense probably damaging 0.99
R9711:Tenm2 UTSW 11 35,915,341 (GRCm39) missense probably damaging 0.99
RF021:Tenm2 UTSW 11 35,915,030 (GRCm39) missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 35,915,027 (GRCm39) missense probably damaging 1.00
X0063:Tenm2 UTSW 11 35,915,557 (GRCm39) missense probably benign
Z1088:Tenm2 UTSW 11 36,164,094 (GRCm39) missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36,191,162 (GRCm39) missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 35,899,061 (GRCm39) missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36,275,957 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGATGGTGACTTTGCCTTTG -3'
(R):5'- TCCCGTGGATCAGTAGCATC -3'

Sequencing Primer
(F):5'- AAGATGGTGACTTTGCCTTTGATCTG -3'
(R):5'- TGCTAATTGAAGGCAGCCTC -3'
Posted On 2022-02-07