Incidental Mutation 'R9169:Tmc2'
ID 696233
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Name transmembrane channel-like gene family 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R9169 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130037114-130106365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130083516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 491 (I491N)
Ref Sequence ENSEMBL: ENSMUSP00000077139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
AlphaFold Q8R4P4
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: I491N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: I491N

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: I491N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: I491N

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A T 7: 41,261,109 (GRCm39) probably benign Het
9330182O14Rik A T 15: 40,005,632 (GRCm39) K17* probably null Het
Adamtsl3 A C 7: 82,223,188 (GRCm39) I990L probably damaging Het
Add1 T A 5: 34,788,122 (GRCm39) S724T possibly damaging Het
Afdn A G 17: 14,072,627 (GRCm39) N865S probably benign Het
Amot A T X: 144,244,745 (GRCm39) L435H Het
Ap1m2 T A 9: 21,223,523 (GRCm39) I8F probably benign Het
Atp8a1 T C 5: 67,824,944 (GRCm39) T811A Het
Axin2 A G 11: 108,822,378 (GRCm39) D310G probably damaging Het
Bin1 T G 18: 32,562,251 (GRCm39) F379L possibly damaging Het
Bin2 C A 15: 100,554,631 (GRCm39) S91I possibly damaging Het
Birc5 A G 11: 117,743,599 (GRCm39) N111S probably benign Het
Blk T A 14: 63,620,130 (GRCm39) N137Y probably damaging Het
Cacna1d G A 14: 29,796,873 (GRCm39) A1534V probably damaging Het
Cacna2d1 T C 5: 16,451,757 (GRCm39) V207A probably damaging Het
Ccr3 A G 9: 123,828,949 (GRCm39) I95V probably benign Het
Celsr2 T C 3: 108,309,862 (GRCm39) D1579G probably benign Het
Cfap36 C A 11: 29,196,541 (GRCm39) K19N probably benign Het
Cfap52 C T 11: 67,844,860 (GRCm39) V70M possibly damaging Het
Chid1 A T 7: 141,093,722 (GRCm39) I298N probably damaging Het
Clstn1 G T 4: 149,731,322 (GRCm39) R888L possibly damaging Het
Col6a5 T A 9: 105,822,596 (GRCm39) T254S unknown Het
Coro6 C T 11: 77,359,329 (GRCm39) P301S probably damaging Het
Cstdc2 A G 2: 148,692,589 (GRCm39) probably null Het
Dchs1 T C 7: 105,422,114 (GRCm39) D102G probably damaging Het
Dnah14 T C 1: 181,433,381 (GRCm39) F353L probably benign Het
Dnajc10 A T 2: 80,163,315 (GRCm39) I344L probably benign Het
Dst T C 1: 34,303,652 (GRCm39) V4026A probably damaging Het
Exo1 A G 1: 175,715,203 (GRCm39) E114G possibly damaging Het
Fabp7 A G 10: 57,662,439 (GRCm39) I109V probably benign Het
Fars2 T C 13: 36,416,109 (GRCm39) F206S probably damaging Het
Gbp8 C T 5: 105,179,155 (GRCm39) A115T possibly damaging Het
Gm17067 T C 7: 42,357,627 (GRCm39) T292A probably benign Het
Gp2 T C 7: 119,041,929 (GRCm39) D532G probably benign Het
Gtf2i C A 5: 134,271,534 (GRCm39) A917S probably damaging Het
Guca1b A G 17: 47,702,827 (GRCm39) E169G possibly damaging Het
Hdac1 A T 4: 129,428,499 (GRCm39) Y24N probably damaging Het
Hepacam T C 9: 37,293,693 (GRCm39) F251L probably damaging Het
Hmcn1 G T 1: 150,506,092 (GRCm39) N3811K probably damaging Het
Htra4 A T 8: 25,520,133 (GRCm39) M391K probably damaging Het
Ino80d T C 1: 63,097,930 (GRCm39) T760A probably benign Het
Ints1 T G 5: 139,748,586 (GRCm39) T1074P probably benign Het
Itga6 A T 2: 71,647,015 (GRCm39) Q75L possibly damaging Het
Mapk14 A C 17: 28,960,814 (GRCm39) N272T probably benign Het
Meikin A T 11: 54,285,517 (GRCm39) T185S possibly damaging Het
Moxd2 C T 6: 40,860,490 (GRCm39) G318D possibly damaging Het
Mtmr3 G A 11: 4,437,739 (GRCm39) T905I probably benign Het
Muc16 A G 9: 18,567,824 (GRCm39) I1565T unknown Het
Myh14 A G 7: 44,271,281 (GRCm39) S1500P possibly damaging Het
Nfkb1 T C 3: 135,310,874 (GRCm39) E475G probably benign Het
Ngef C A 1: 87,473,581 (GRCm39) R67L probably benign Het
Olr1 T C 6: 129,470,528 (GRCm39) E213G probably damaging Het
Or13c3 T A 4: 52,856,052 (GRCm39) I154F probably damaging Het
Or5b124 A G 19: 13,610,903 (GRCm39) I143V probably benign Het
Or8g21 A G 9: 38,906,573 (GRCm39) S53P probably benign Het
Or9r3 A C 10: 129,947,723 (GRCm39) I312R probably benign Het
Pcdhga3 C T 18: 37,809,088 (GRCm39) L514F probably damaging Het
Pcnt A G 10: 76,221,572 (GRCm39) M2018T possibly damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pik3ca T C 3: 32,503,755 (GRCm39) probably null Het
Psapl1 A G 5: 36,362,880 (GRCm39) S491G possibly damaging Het
Psmf1 A T 2: 151,577,457 (GRCm39) D73E probably benign Het
Ptprcap A G 19: 4,206,358 (GRCm39) D147G probably benign Het
Ramacl T C 13: 67,056,063 (GRCm39) F19L probably damaging Het
Rdh8 T A 9: 20,736,935 (GRCm39) V309E possibly damaging Het
Rhobtb3 T A 13: 76,041,121 (GRCm39) T396S probably benign Het
Rpa1 A T 11: 75,200,999 (GRCm39) L475* probably null Het
Rtkn T A 6: 83,129,190 (GRCm39) S562T probably damaging Het
Saxo5 A T 8: 3,525,967 (GRCm39) Y40F possibly damaging Het
Scamp1 C T 13: 94,389,533 (GRCm39) D35N probably benign Het
Scarb1 C T 5: 125,371,146 (GRCm39) A309T probably damaging Het
Scube1 G A 15: 83,543,298 (GRCm39) T180M possibly damaging Het
Sez6 T G 11: 77,868,473 (GRCm39) F945V probably damaging Het
Sf3a1 C T 11: 4,116,681 (GRCm39) T124M probably benign Het
Smchd1 T C 17: 71,722,659 (GRCm39) K759E probably damaging Het
Sort1 C A 3: 108,247,994 (GRCm39) C446* probably null Het
Sun1 T A 5: 139,219,273 (GRCm39) S360T probably benign Het
Supv3l1 A G 10: 62,268,238 (GRCm39) F536L probably damaging Het
Taar6 A C 10: 23,861,273 (GRCm39) V91G probably damaging Het
Themis C A 10: 28,658,233 (GRCm39) T420N probably benign Het
Thoc2l T A 5: 104,666,348 (GRCm39) L290H probably damaging Het
Trmt112 T C 19: 6,888,187 (GRCm39) I113T probably damaging Het
Ttc14 C T 3: 33,857,071 (GRCm39) Q183* probably null Het
Txndc16 T A 14: 45,373,385 (GRCm39) D748V probably damaging Het
Xkr6 A G 14: 63,844,067 (GRCm39) D30G possibly damaging Het
Zc3h14 C T 12: 98,745,505 (GRCm39) S498L probably damaging Het
Zc3h7b A C 15: 81,661,184 (GRCm39) D341A probably benign Het
Zfp108 T A 7: 23,960,923 (GRCm39) C505S probably damaging Het
Zfp354c A C 11: 50,706,088 (GRCm39) L329R probably damaging Het
Zfyve16 T A 13: 92,657,871 (GRCm39) D680V probably damaging Het
Znfx1 A G 2: 166,897,185 (GRCm39) F580L probably benign Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130,103,224 (GRCm39) missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130,105,932 (GRCm39) missense probably benign 0.02
IGL01094:Tmc2 APN 2 130,102,086 (GRCm39) splice site probably benign
IGL01331:Tmc2 APN 2 130,074,276 (GRCm39) missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130,102,144 (GRCm39) nonsense probably null
IGL01926:Tmc2 APN 2 130,102,160 (GRCm39) missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130,082,073 (GRCm39) missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130,071,126 (GRCm39) missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130,082,050 (GRCm39) missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130,071,107 (GRCm39) missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130,082,116 (GRCm39) missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130,068,182 (GRCm39) missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130,090,571 (GRCm39) missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130,044,023 (GRCm39) missense probably benign 0.00
R1183:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130,090,650 (GRCm39) missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130,090,682 (GRCm39) missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130,089,880 (GRCm39) missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130,089,854 (GRCm39) missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130,098,036 (GRCm39) missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130,102,145 (GRCm39) missense probably benign 0.34
R1776:Tmc2 UTSW 2 130,076,789 (GRCm39) missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130,090,676 (GRCm39) missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130,056,584 (GRCm39) splice site probably benign
R2020:Tmc2 UTSW 2 130,074,305 (GRCm39) missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130,056,483 (GRCm39) splice site probably null
R3968:Tmc2 UTSW 2 130,043,991 (GRCm39) missense probably benign 0.02
R4732:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4733:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4989:Tmc2 UTSW 2 130,043,961 (GRCm39) missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130,076,738 (GRCm39) missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130,082,035 (GRCm39) missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130,083,564 (GRCm39) missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130,074,306 (GRCm39) missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130,106,123 (GRCm39) missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130,103,300 (GRCm39) missense probably benign
R7132:Tmc2 UTSW 2 130,074,329 (GRCm39) missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130,076,724 (GRCm39) missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130,038,497 (GRCm39) critical splice donor site probably null
R8167:Tmc2 UTSW 2 130,083,488 (GRCm39) missense probably benign 0.04
R8554:Tmc2 UTSW 2 130,106,084 (GRCm39) missense probably benign 0.00
R9134:Tmc2 UTSW 2 130,074,321 (GRCm39) missense probably benign 0.21
R9209:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R9232:Tmc2 UTSW 2 130,085,049 (GRCm39) missense probably damaging 1.00
R9725:Tmc2 UTSW 2 130,089,881 (GRCm39) missense probably damaging 0.99
X0019:Tmc2 UTSW 2 130,050,205 (GRCm39) missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130,043,892 (GRCm39) missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130,050,216 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTATACACTGAGCCATCTCACCATC -3'
(R):5'- CTATGACAGCTGTGAAGCAAC -3'

Sequencing Primer
(F):5'- TCCCCAGCCCCATGAATCATG -3'
(R):5'- TGTGAAGCAACATAGAAAAACCTGC -3'
Posted On 2022-02-07