Mutagenetix > Incidental Mutation

Incidental Mutation 'R9169:Dchs1'

696264

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9169 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105772907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 102 (D102G)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078482]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078482
AA Change: D102G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: D102G

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (92/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	T	7: 41,611,685		probably benign	Het
9230104L09Rik	A	G	2: 148,850,669		probably null	Het
9330182O14Rik	A	T	15: 40,142,236	K17*	probably null	Het
Adamtsl3	A	C	7: 82,573,980	I990L	probably damaging	Het
Add1	T	A	5: 34,630,778	S724T	possibly damaging	Het
Afdn	A	G	17: 13,852,365	N865S	probably benign	Het
Amot	A	T	X: 145,461,749	L435H		Het
Ap1m2	T	A	9: 21,312,227	I8F	probably benign	Het
Atp8a1	T	C	5: 67,667,601	T811A		Het
Axin2	A	G	11: 108,931,552	D310G	probably damaging	Het
BC005561	T	A	5: 104,518,482	L290H	probably damaging	Het
Bin1	T	G	18: 32,429,198	F379L	possibly damaging	Het
Bin2	C	A	15: 100,656,750	S91I	possibly damaging	Het
Birc5	A	G	11: 117,852,773	N111S	probably benign	Het
Blk	T	A	14: 63,382,681	N137Y	probably damaging	Het
Cacna1d	G	A	14: 30,074,916	A1534V	probably damaging	Het
Cacna2d1	T	C	5: 16,246,759	V207A	probably damaging	Het
Ccr3	A	G	9: 124,028,912	I95V	probably benign	Het
Celsr2	T	C	3: 108,402,546	D1579G	probably benign	Het
Cfap36	C	A	11: 29,246,541	K19N	probably benign	Het
Cfap52	C	T	11: 67,954,034	V70M	possibly damaging	Het
Chid1	A	T	7: 141,513,809	I298N	probably damaging	Het
Clstn1	G	T	4: 149,646,865	R888L	possibly damaging	Het
Col6a5	T	A	9: 105,945,397	T254S	unknown	Het
Coro6	C	T	11: 77,468,503	P301S	probably damaging	Het
Dnah14	T	C	1: 181,605,816	F353L	probably benign	Het
Dnajc10	A	T	2: 80,332,971	I344L	probably benign	Het
Dst	T	C	1: 34,264,571	V4026A	probably damaging	Het
Exo1	A	G	1: 175,887,637	E114G	possibly damaging	Het
Fabp7	A	G	10: 57,786,343	I109V	probably benign	Het
Fars2	T	C	13: 36,232,126	F206S	probably damaging	Het
Gbp8	C	T	5: 105,031,289	A115T	possibly damaging	Het
Gm10767	T	C	13: 66,907,999	F19L	probably damaging	Het
Gm17067	T	C	7: 42,708,203	T292A	probably benign	Het
Gp2	T	C	7: 119,442,706	D532G	probably benign	Het
Gtf2i	C	A	5: 134,242,680	A917S	probably damaging	Het
Guca1b	A	G	17: 47,391,902	E169G	possibly damaging	Het
Hdac1	A	T	4: 129,534,706	Y24N	probably damaging	Het
Hepacam	T	C	9: 37,382,397	F251L	probably damaging	Het
Hmcn1	G	T	1: 150,630,341	N3811K	probably damaging	Het
Htra4	A	T	8: 25,030,117	M391K	probably damaging	Het
Ino80d	T	C	1: 63,058,771	T760A	probably benign	Het
Ints1	T	G	5: 139,762,831	T1074P	probably benign	Het
Itga6	A	T	2: 71,816,671	Q75L	possibly damaging	Het
Mapk14	A	C	17: 28,741,840	N272T	probably benign	Het
Meikin	A	T	11: 54,394,691	T185S	possibly damaging	Het
Moxd2	C	T	6: 40,883,556	G318D	possibly damaging	Het
Mtmr3	G	A	11: 4,487,739	T905I	probably benign	Het
Muc16	A	G	9: 18,656,528	I1565T	unknown	Het
Myh14	A	G	7: 44,621,857	S1500P	possibly damaging	Het
Nfkb1	T	C	3: 135,605,113	E475G	probably benign	Het
Ngef	C	A	1: 87,545,859	R67L	probably benign	Het
Olfr1489	A	G	19: 13,633,539	I143V	probably benign	Het
Olfr273	T	A	4: 52,856,052	I154F	probably damaging	Het
Olfr823	A	C	10: 130,111,854	I312R	probably benign	Het
Olfr935	A	G	9: 38,995,277	S53P	probably benign	Het
Olr1	T	C	6: 129,493,565	E213G	probably damaging	Het
Pcdhga3	C	T	18: 37,676,035	L514F	probably damaging	Het
Pcnt	A	G	10: 76,385,738	M2018T	possibly damaging	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pik3ca	T	C	3: 32,449,606		probably null	Het
Psapl1	A	G	5: 36,205,536	S491G	possibly damaging	Het
Psmf1	A	T	2: 151,735,537	D73E	probably benign	Het
Ptprcap	A	G	19: 4,156,359	D147G	probably benign	Het
Rdh8	T	A	9: 20,825,639	V309E	possibly damaging	Het
Rhobtb3	T	A	13: 75,893,002	T396S	probably benign	Het
Rpa1	A	T	11: 75,310,173	L475*	probably null	Het
Rtkn	T	A	6: 83,152,209	S562T	probably damaging	Het
Scamp1	C	T	13: 94,253,025	D35N	probably benign	Het
Scarb1	C	T	5: 125,294,082	A309T	probably damaging	Het
Scube1	G	A	15: 83,659,097	T180M	possibly damaging	Het
Sez6	T	G	11: 77,977,647	F945V	probably damaging	Het
Sf3a1	C	T	11: 4,166,681	T124M	probably benign	Het
Smchd1	T	C	17: 71,415,664	K759E	probably damaging	Het
Sort1	C	A	3: 108,340,678	C446*	probably null	Het
Sun1	T	A	5: 139,233,518	S360T	probably benign	Het
Supv3l1	A	G	10: 62,432,459	F536L	probably damaging	Het
Taar6	A	C	10: 23,985,375	V91G	probably damaging	Het
Tex45	A	T	8: 3,475,967	Y40F	possibly damaging	Het
Themis	C	A	10: 28,782,237	T420N	probably benign	Het
Tmc2	T	A	2: 130,241,596	I491N	probably damaging	Het
Trmt112	T	C	19: 6,910,819	I113T	probably damaging	Het
Ttc14	C	T	3: 33,802,922	Q183*	probably null	Het
Txndc16	T	A	14: 45,135,928	D748V	probably damaging	Het
Xkr6	A	G	14: 63,606,618	D30G	possibly damaging	Het
Zc3h14	C	T	12: 98,779,246	S498L	probably damaging	Het
Zc3h7b	A	C	15: 81,776,983	D341A	probably benign	Het
Zfp108	T	A	7: 24,261,498	C505S	probably damaging	Het
Zfp354c	A	C	11: 50,815,261	L329R	probably damaging	Het
Zfyve16	T	A	13: 92,521,363	D680V	probably damaging	Het
Znfx1	A	G	2: 167,055,265	F580L	probably benign	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGCGCATACCCTTGGGTTC -3'
(R):5'- CCTACAGATCGACGAGGAAC -3'

Sequencing Primer
(F):5'- ATCTGCATCACGAGCAGG -3'
(R):5'- GATCGACGAGGAACAACCAGC -3'

Posted On

2022-02-07