Mutagenetix > Incidental Mutation

Incidental Mutation 'R9169:Smchd1'

696310

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.842) question?

Stock #

R9169 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71415664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 759 (K759E)

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably damaging
Transcript: ENSMUST00000127430
AA Change: K759E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: K759E

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (92/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	T	7: 41,611,685		probably benign	Het
9230104L09Rik	A	G	2: 148,850,669		probably null	Het
9330182O14Rik	A	T	15: 40,142,236	K17*	probably null	Het
Adamtsl3	A	C	7: 82,573,980	I990L	probably damaging	Het
Add1	T	A	5: 34,630,778	S724T	possibly damaging	Het
Afdn	A	G	17: 13,852,365	N865S	probably benign	Het
Amot	A	T	X: 145,461,749	L435H		Het
Ap1m2	T	A	9: 21,312,227	I8F	probably benign	Het
Atp8a1	T	C	5: 67,667,601	T811A		Het
Axin2	A	G	11: 108,931,552	D310G	probably damaging	Het
BC005561	T	A	5: 104,518,482	L290H	probably damaging	Het
Bin1	T	G	18: 32,429,198	F379L	possibly damaging	Het
Bin2	C	A	15: 100,656,750	S91I	possibly damaging	Het
Birc5	A	G	11: 117,852,773	N111S	probably benign	Het
Blk	T	A	14: 63,382,681	N137Y	probably damaging	Het
Cacna1d	G	A	14: 30,074,916	A1534V	probably damaging	Het
Cacna2d1	T	C	5: 16,246,759	V207A	probably damaging	Het
Ccr3	A	G	9: 124,028,912	I95V	probably benign	Het
Celsr2	T	C	3: 108,402,546	D1579G	probably benign	Het
Cfap36	C	A	11: 29,246,541	K19N	probably benign	Het
Cfap52	C	T	11: 67,954,034	V70M	possibly damaging	Het
Chid1	A	T	7: 141,513,809	I298N	probably damaging	Het
Clstn1	G	T	4: 149,646,865	R888L	possibly damaging	Het
Col6a5	T	A	9: 105,945,397	T254S	unknown	Het
Coro6	C	T	11: 77,468,503	P301S	probably damaging	Het
Dchs1	T	C	7: 105,772,907	D102G	probably damaging	Het
Dnah14	T	C	1: 181,605,816	F353L	probably benign	Het
Dnajc10	A	T	2: 80,332,971	I344L	probably benign	Het
Dst	T	C	1: 34,264,571	V4026A	probably damaging	Het
Exo1	A	G	1: 175,887,637	E114G	possibly damaging	Het
Fabp7	A	G	10: 57,786,343	I109V	probably benign	Het
Fars2	T	C	13: 36,232,126	F206S	probably damaging	Het
Gbp8	C	T	5: 105,031,289	A115T	possibly damaging	Het
Gm10767	T	C	13: 66,907,999	F19L	probably damaging	Het
Gm17067	T	C	7: 42,708,203	T292A	probably benign	Het
Gp2	T	C	7: 119,442,706	D532G	probably benign	Het
Gtf2i	C	A	5: 134,242,680	A917S	probably damaging	Het
Guca1b	A	G	17: 47,391,902	E169G	possibly damaging	Het
Hdac1	A	T	4: 129,534,706	Y24N	probably damaging	Het
Hepacam	T	C	9: 37,382,397	F251L	probably damaging	Het
Hmcn1	G	T	1: 150,630,341	N3811K	probably damaging	Het
Htra4	A	T	8: 25,030,117	M391K	probably damaging	Het
Ino80d	T	C	1: 63,058,771	T760A	probably benign	Het
Ints1	T	G	5: 139,762,831	T1074P	probably benign	Het
Itga6	A	T	2: 71,816,671	Q75L	possibly damaging	Het
Mapk14	A	C	17: 28,741,840	N272T	probably benign	Het
Meikin	A	T	11: 54,394,691	T185S	possibly damaging	Het
Moxd2	C	T	6: 40,883,556	G318D	possibly damaging	Het
Mtmr3	G	A	11: 4,487,739	T905I	probably benign	Het
Muc16	A	G	9: 18,656,528	I1565T	unknown	Het
Myh14	A	G	7: 44,621,857	S1500P	possibly damaging	Het
Nfkb1	T	C	3: 135,605,113	E475G	probably benign	Het
Ngef	C	A	1: 87,545,859	R67L	probably benign	Het
Olfr1489	A	G	19: 13,633,539	I143V	probably benign	Het
Olfr273	T	A	4: 52,856,052	I154F	probably damaging	Het
Olfr823	A	C	10: 130,111,854	I312R	probably benign	Het
Olfr935	A	G	9: 38,995,277	S53P	probably benign	Het
Olr1	T	C	6: 129,493,565	E213G	probably damaging	Het
Pcdhga3	C	T	18: 37,676,035	L514F	probably damaging	Het
Pcnt	A	G	10: 76,385,738	M2018T	possibly damaging	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pik3ca	T	C	3: 32,449,606		probably null	Het
Psapl1	A	G	5: 36,205,536	S491G	possibly damaging	Het
Psmf1	A	T	2: 151,735,537	D73E	probably benign	Het
Ptprcap	A	G	19: 4,156,359	D147G	probably benign	Het
Rdh8	T	A	9: 20,825,639	V309E	possibly damaging	Het
Rhobtb3	T	A	13: 75,893,002	T396S	probably benign	Het
Rpa1	A	T	11: 75,310,173	L475*	probably null	Het
Rtkn	T	A	6: 83,152,209	S562T	probably damaging	Het
Scamp1	C	T	13: 94,253,025	D35N	probably benign	Het
Scarb1	C	T	5: 125,294,082	A309T	probably damaging	Het
Scube1	G	A	15: 83,659,097	T180M	possibly damaging	Het
Sez6	T	G	11: 77,977,647	F945V	probably damaging	Het
Sf3a1	C	T	11: 4,166,681	T124M	probably benign	Het
Sort1	C	A	3: 108,340,678	C446*	probably null	Het
Sun1	T	A	5: 139,233,518	S360T	probably benign	Het
Supv3l1	A	G	10: 62,432,459	F536L	probably damaging	Het
Taar6	A	C	10: 23,985,375	V91G	probably damaging	Het
Tex45	A	T	8: 3,475,967	Y40F	possibly damaging	Het
Themis	C	A	10: 28,782,237	T420N	probably benign	Het
Tmc2	T	A	2: 130,241,596	I491N	probably damaging	Het
Trmt112	T	C	19: 6,910,819	I113T	probably damaging	Het
Ttc14	C	T	3: 33,802,922	Q183*	probably null	Het
Txndc16	T	A	14: 45,135,928	D748V	probably damaging	Het
Xkr6	A	G	14: 63,606,618	D30G	possibly damaging	Het
Zc3h14	C	T	12: 98,779,246	S498L	probably damaging	Het
Zc3h7b	A	C	15: 81,776,983	D341A	probably benign	Het
Zfp108	T	A	7: 24,261,498	C505S	probably damaging	Het
Zfp354c	A	C	11: 50,815,261	L329R	probably damaging	Het
Zfyve16	T	A	13: 92,521,363	D680V	probably damaging	Het
Znfx1	A	G	2: 167,055,265	F580L	probably benign	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAATGTAGGGATGGAGTTTG -3'
(R):5'- TGCACTCTTCACGTGAAAGC -3'

Sequencing Primer
(F):5'- ATCCATAGCTTCAGTCCCAGGG -3'
(R):5'- CACGTGAAAGCACTTATAATGAGC -3'

Posted On

2022-02-07