Incidental Mutation 'R9170:Slco4a1'
ID 696327
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Name solute carrier organic anion transporter family, member 4a1
Synonyms Slc21a12, OATP-E
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R9170 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180456245-180474867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180464685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 220 (D220G)
Ref Sequence ENSEMBL: ENSMUSP00000045023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
AlphaFold Q8K078
Predicted Effect probably benign
Transcript: ENSMUST00000038225
AA Change: D220G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: D220G

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038259
AA Change: D220G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: D220G

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,404 Q565L possibly damaging Het
Adam4 T C 12: 81,419,742 K702E probably benign Het
Agbl1 T C 7: 76,335,321 I162T Het
Agpat2 A T 2: 26,597,218 I101N possibly damaging Het
Amot A T X: 145,461,749 L435H Het
Arhgap32 G A 9: 32,250,743 R330H possibly damaging Het
Asb4 T A 6: 5,390,775 I56N probably benign Het
Atp2a2 C T 5: 122,466,024 V449M possibly damaging Het
Bend4 A G 5: 67,417,737 L267P probably damaging Het
Catspere2 T A 1: 178,140,383 N745K probably benign Het
Celf2 A G 2: 6,549,835 F484L possibly damaging Het
Chd3 T C 11: 69,350,822 D1495G possibly damaging Het
Chrna3 A T 9: 55,026,387 V8D unknown Het
Cog3 T C 14: 75,729,362 Y466C probably damaging Het
Col5a1 A G 2: 27,951,351 E328G unknown Het
Col7a1 A G 9: 108,956,639 Y392C unknown Het
Crtc3 A T 7: 80,598,949 N255K probably damaging Het
Dnaaf1 T C 8: 119,575,456 I32T probably benign Het
Dner A T 1: 84,534,926 C307S probably damaging Het
Dzip3 T C 16: 48,952,038 K423E possibly damaging Het
Eif2b4 A G 5: 31,188,049 S414P probably damaging Het
Elp4 T C 2: 105,794,546 E334G probably damaging Het
Emilin2 T A 17: 71,280,694 N141I probably benign Het
Fstl1 T A 16: 37,826,778 V170E probably damaging Het
Fxn A G 19: 24,267,323 I151T probably damaging Het
Gm13083 T C 4: 143,615,030 S10P possibly damaging Het
Gtf3c4 A T 2: 28,840,202 V9E possibly damaging Het
Ino80d A G 1: 63,093,448 S19P probably damaging Het
Kank3 T G 17: 33,818,268 L370R probably damaging Het
Large1 T A 8: 72,816,017 Y693F probably benign Het
Lig4 C A 8: 9,972,202 W526L probably damaging Het
Mib1 C T 18: 10,726,437 P45S probably benign Het
Ndufaf6 T C 4: 11,070,301 K107E probably benign Het
Nf1 T C 11: 79,545,465 L1977P probably damaging Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr605 G A 7: 103,442,643 P160L probably damaging Het
Olfr625-ps1 T A 7: 103,683,197 F160I probably benign Het
Pappa G A 4: 65,340,725 R1570Q probably damaging Het
Parp6 G A 9: 59,623,930 A32T Het
Pclo A G 5: 14,681,054 Q64R Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prf1 A C 10: 61,300,437 D164A probably damaging Het
Rarres1 A G 3: 67,479,591 V226A probably damaging Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Rnf123 A G 9: 108,071,176 L106P probably damaging Het
Scnn1b A T 7: 121,912,103 T338S probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc9a5 T C 8: 105,353,507 V94A probably damaging Het
Sult1c1 T C 17: 53,962,172 D272G possibly damaging Het
Tgm1 T C 14: 55,708,898 N427S probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tnni3 A T 7: 4,518,377 F209L probably damaging Het
Ttn T A 2: 76,915,568 S5046C probably damaging Het
Tubb2a T A 13: 34,076,645 I24L probably benign Het
Uevld C A 7: 46,937,998 G318V probably damaging Het
Unkl T C 17: 25,229,376 S308P probably benign Het
Vmn1r159 C A 7: 22,843,340 C89F probably damaging Het
Wee2 T G 6: 40,461,043 S302A probably benign Het
Ydjc T C 16: 17,147,802 C144R probably benign Het
Zc3h12c A G 9: 52,116,119 S667P probably benign Het
Zfp280b T A 10: 76,038,817 Y177N probably benign Het
Zfp354b C T 11: 50,923,535 E188K probably benign Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8203:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R8504:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R9166:Slco4a1 UTSW 2 180464241 missense probably benign 0.00
R9210:Slco4a1 UTSW 2 180472478 missense probably damaging 1.00
R9455:Slco4a1 UTSW 2 180473577 missense probably benign 0.05
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCGCCAGCTCCTATGACATC -3'
(R):5'- CACCCTGATTCCTTGGCAAATC -3'

Sequencing Primer
(F):5'- ATGACATCGCTGCCTGC -3'
(R):5'- TCCTACTCACCGATATAGATGGG -3'
Posted On 2022-02-07