Incidental Mutation 'R9170:Agbl1'
ID 696344
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene Name ATP/GTP binding protein-like 1
Synonyms Nna1-l1, EG244071
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9170 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 76229887-77124698 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76335321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 162 (I162T)
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156166]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: I162T

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,404 Q565L possibly damaging Het
Adam4 T C 12: 81,419,742 K702E probably benign Het
Agpat2 A T 2: 26,597,218 I101N possibly damaging Het
Amot A T X: 145,461,749 L435H Het
Arhgap32 G A 9: 32,250,743 R330H possibly damaging Het
Asb4 T A 6: 5,390,775 I56N probably benign Het
Atp2a2 C T 5: 122,466,024 V449M possibly damaging Het
Bend4 A G 5: 67,417,737 L267P probably damaging Het
Catspere2 T A 1: 178,140,383 N745K probably benign Het
Celf2 A G 2: 6,549,835 F484L possibly damaging Het
Chd3 T C 11: 69,350,822 D1495G possibly damaging Het
Chrna3 A T 9: 55,026,387 V8D unknown Het
Cog3 T C 14: 75,729,362 Y466C probably damaging Het
Col5a1 A G 2: 27,951,351 E328G unknown Het
Col7a1 A G 9: 108,956,639 Y392C unknown Het
Crtc3 A T 7: 80,598,949 N255K probably damaging Het
Dnaaf1 T C 8: 119,575,456 I32T probably benign Het
Dner A T 1: 84,534,926 C307S probably damaging Het
Dzip3 T C 16: 48,952,038 K423E possibly damaging Het
Eif2b4 A G 5: 31,188,049 S414P probably damaging Het
Elp4 T C 2: 105,794,546 E334G probably damaging Het
Emilin2 T A 17: 71,280,694 N141I probably benign Het
Fstl1 T A 16: 37,826,778 V170E probably damaging Het
Fxn A G 19: 24,267,323 I151T probably damaging Het
Gm13083 T C 4: 143,615,030 S10P possibly damaging Het
Gtf3c4 A T 2: 28,840,202 V9E possibly damaging Het
Ino80d A G 1: 63,093,448 S19P probably damaging Het
Kank3 T G 17: 33,818,268 L370R probably damaging Het
Large1 T A 8: 72,816,017 Y693F probably benign Het
Lig4 C A 8: 9,972,202 W526L probably damaging Het
Mib1 C T 18: 10,726,437 P45S probably benign Het
Ndufaf6 T C 4: 11,070,301 K107E probably benign Het
Nf1 T C 11: 79,545,465 L1977P probably damaging Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr605 G A 7: 103,442,643 P160L probably damaging Het
Olfr625-ps1 T A 7: 103,683,197 F160I probably benign Het
Pappa G A 4: 65,340,725 R1570Q probably damaging Het
Parp6 G A 9: 59,623,930 A32T Het
Pclo A G 5: 14,681,054 Q64R Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prf1 A C 10: 61,300,437 D164A probably damaging Het
Rarres1 A G 3: 67,479,591 V226A probably damaging Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Rnf123 A G 9: 108,071,176 L106P probably damaging Het
Scnn1b A T 7: 121,912,103 T338S probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc9a5 T C 8: 105,353,507 V94A probably damaging Het
Slco4a1 A G 2: 180,464,685 D220G probably benign Het
Sult1c1 T C 17: 53,962,172 D272G possibly damaging Het
Tgm1 T C 14: 55,708,898 N427S probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tnni3 A T 7: 4,518,377 F209L probably damaging Het
Ttn T A 2: 76,915,568 S5046C probably damaging Het
Tubb2a T A 13: 34,076,645 I24L probably benign Het
Uevld C A 7: 46,937,998 G318V probably damaging Het
Unkl T C 17: 25,229,376 S308P probably benign Het
Vmn1r159 C A 7: 22,843,340 C89F probably damaging Het
Wee2 T G 6: 40,461,043 S302A probably benign Het
Ydjc T C 16: 17,147,802 C144R probably benign Het
Zc3h12c A G 9: 52,116,119 S667P probably benign Het
Zfp280b T A 10: 76,038,817 Y177N probably benign Het
Zfp354b C T 11: 50,923,535 E188K probably benign Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
R8406:Agbl1 UTSW 7 76418667 missense
R8432:Agbl1 UTSW 7 77124686 missense unknown
R8704:Agbl1 UTSW 7 76589554 splice site probably benign
R8830:Agbl1 UTSW 7 76335311 missense
R8985:Agbl1 UTSW 7 76320156 missense
R9113:Agbl1 UTSW 7 76589477 missense unknown
R9229:Agbl1 UTSW 7 77124522 missense unknown
R9255:Agbl1 UTSW 7 76766402 missense unknown
R9391:Agbl1 UTSW 7 76421854 missense unknown
R9646:Agbl1 UTSW 7 76425900 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCTACTCACTAGGCTGTTA -3'
(R):5'- AACTTGGGGTTGGGTAGAGA -3'

Sequencing Primer
(F):5'- CCTACTCACTAGGCTGTTAAGAGAG -3'
(R):5'- AAGCAGATTGATATGGGATAGAGCC -3'
Posted On 2022-02-07