Incidental Mutation 'R9170:Large1'
ID 696351
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock # R9170 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72816017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 693 (Y693F)
Ref Sequence ENSEMBL: ENSMUSP00000004497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably benign
Transcript: ENSMUST00000004497
AA Change: Y693F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: Y693F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119826
AA Change: Y693F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: Y693F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212459
AA Change: Y693F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,404 Q565L possibly damaging Het
Adam4 T C 12: 81,419,742 K702E probably benign Het
Agbl1 T C 7: 76,335,321 I162T Het
Agpat2 A T 2: 26,597,218 I101N possibly damaging Het
Amot A T X: 145,461,749 L435H Het
Arhgap32 G A 9: 32,250,743 R330H possibly damaging Het
Asb4 T A 6: 5,390,775 I56N probably benign Het
Atp2a2 C T 5: 122,466,024 V449M possibly damaging Het
Bend4 A G 5: 67,417,737 L267P probably damaging Het
Catspere2 T A 1: 178,140,383 N745K probably benign Het
Celf2 A G 2: 6,549,835 F484L possibly damaging Het
Chd3 T C 11: 69,350,822 D1495G possibly damaging Het
Chrna3 A T 9: 55,026,387 V8D unknown Het
Cog3 T C 14: 75,729,362 Y466C probably damaging Het
Col5a1 A G 2: 27,951,351 E328G unknown Het
Col7a1 A G 9: 108,956,639 Y392C unknown Het
Crtc3 A T 7: 80,598,949 N255K probably damaging Het
Dnaaf1 T C 8: 119,575,456 I32T probably benign Het
Dner A T 1: 84,534,926 C307S probably damaging Het
Dzip3 T C 16: 48,952,038 K423E possibly damaging Het
Eif2b4 A G 5: 31,188,049 S414P probably damaging Het
Elp4 T C 2: 105,794,546 E334G probably damaging Het
Emilin2 T A 17: 71,280,694 N141I probably benign Het
Fstl1 T A 16: 37,826,778 V170E probably damaging Het
Fxn A G 19: 24,267,323 I151T probably damaging Het
Gm13083 T C 4: 143,615,030 S10P possibly damaging Het
Gtf3c4 A T 2: 28,840,202 V9E possibly damaging Het
Ino80d A G 1: 63,093,448 S19P probably damaging Het
Kank3 T G 17: 33,818,268 L370R probably damaging Het
Lig4 C A 8: 9,972,202 W526L probably damaging Het
Mib1 C T 18: 10,726,437 P45S probably benign Het
Ndufaf6 T C 4: 11,070,301 K107E probably benign Het
Nf1 T C 11: 79,545,465 L1977P probably damaging Het
Nme4 G T 17: 26,095,415 A13E probably benign Het
Olfr605 G A 7: 103,442,643 P160L probably damaging Het
Olfr625-ps1 T A 7: 103,683,197 F160I probably benign Het
Pappa G A 4: 65,340,725 R1570Q probably damaging Het
Parp6 G A 9: 59,623,930 A32T Het
Pclo A G 5: 14,681,054 Q64R Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prf1 A C 10: 61,300,437 D164A probably damaging Het
Rarres1 A G 3: 67,479,591 V226A probably damaging Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Rnf123 A G 9: 108,071,176 L106P probably damaging Het
Scnn1b A T 7: 121,912,103 T338S probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc9a5 T C 8: 105,353,507 V94A probably damaging Het
Slco4a1 A G 2: 180,464,685 D220G probably benign Het
Sult1c1 T C 17: 53,962,172 D272G possibly damaging Het
Tgm1 T C 14: 55,708,898 N427S probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tnni3 A T 7: 4,518,377 F209L probably damaging Het
Ttn T A 2: 76,915,568 S5046C probably damaging Het
Tubb2a T A 13: 34,076,645 I24L probably benign Het
Uevld C A 7: 46,937,998 G318V probably damaging Het
Unkl T C 17: 25,229,376 S308P probably benign Het
Vmn1r159 C A 7: 22,843,340 C89F probably damaging Het
Wee2 T G 6: 40,461,043 S302A probably benign Het
Ydjc T C 16: 17,147,802 C144R probably benign Het
Zc3h12c A G 9: 52,116,119 S667P probably benign Het
Zfp280b T A 10: 76,038,817 Y177N probably benign Het
Zfp354b C T 11: 50,923,535 E188K probably benign Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGAGATATTTCAAGGCAGC -3'
(R):5'- TATATGGAGAGCCGCTGGAG -3'

Sequencing Primer
(F):5'- CAAAGCCATATCGTCGGGACATG -3'
(R):5'- CCCATAAAGTATGAGTTTTACCCTC -3'
Posted On 2022-02-07