Mutagenetix > Incidental Mutation

Incidental Mutation 'R9170:Rnf123'

696358

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R9170 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108071176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 106 (L106P)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: L106P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: L106P

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: L106P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: L106P

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: L106P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: L106P

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161828
AA Change: L106P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: L106P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: L106P

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: L106P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: L106P

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,684,404	Q565L	possibly damaging	Het
Adam4	T	C	12: 81,419,742	K702E	probably benign	Het
Agbl1	T	C	7: 76,335,321	I162T		Het
Agpat2	A	T	2: 26,597,218	I101N	possibly damaging	Het
Amot	A	T	X: 145,461,749	L435H		Het
Arhgap32	G	A	9: 32,250,743	R330H	possibly damaging	Het
Asb4	T	A	6: 5,390,775	I56N	probably benign	Het
Atp2a2	C	T	5: 122,466,024	V449M	possibly damaging	Het
Bend4	A	G	5: 67,417,737	L267P	probably damaging	Het
Catspere2	T	A	1: 178,140,383	N745K	probably benign	Het
Celf2	A	G	2: 6,549,835	F484L	possibly damaging	Het
Chd3	T	C	11: 69,350,822	D1495G	possibly damaging	Het
Chrna3	A	T	9: 55,026,387	V8D	unknown	Het
Cog3	T	C	14: 75,729,362	Y466C	probably damaging	Het
Col5a1	A	G	2: 27,951,351	E328G	unknown	Het
Col7a1	A	G	9: 108,956,639	Y392C	unknown	Het
Crtc3	A	T	7: 80,598,949	N255K	probably damaging	Het
Dnaaf1	T	C	8: 119,575,456	I32T	probably benign	Het
Dner	A	T	1: 84,534,926	C307S	probably damaging	Het
Dzip3	T	C	16: 48,952,038	K423E	possibly damaging	Het
Eif2b4	A	G	5: 31,188,049	S414P	probably damaging	Het
Elp4	T	C	2: 105,794,546	E334G	probably damaging	Het
Emilin2	T	A	17: 71,280,694	N141I	probably benign	Het
Fstl1	T	A	16: 37,826,778	V170E	probably damaging	Het
Fxn	A	G	19: 24,267,323	I151T	probably damaging	Het
Gm13083	T	C	4: 143,615,030	S10P	possibly damaging	Het
Gtf3c4	A	T	2: 28,840,202	V9E	possibly damaging	Het
Ino80d	A	G	1: 63,093,448	S19P	probably damaging	Het
Kank3	T	G	17: 33,818,268	L370R	probably damaging	Het
Large1	T	A	8: 72,816,017	Y693F	probably benign	Het
Lig4	C	A	8: 9,972,202	W526L	probably damaging	Het
Mib1	C	T	18: 10,726,437	P45S	probably benign	Het
Ndufaf6	T	C	4: 11,070,301	K107E	probably benign	Het
Nf1	T	C	11: 79,545,465	L1977P	probably damaging	Het
Nme4	G	T	17: 26,095,415	A13E	probably benign	Het
Olfr605	G	A	7: 103,442,643	P160L	probably damaging	Het
Olfr625-ps1	T	A	7: 103,683,197	F160I	probably benign	Het
Pappa	G	A	4: 65,340,725	R1570Q	probably damaging	Het
Parp6	G	A	9: 59,623,930	A32T		Het
Pclo	A	G	5: 14,681,054	Q64R		Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Prdm13	C	G	4: 21,679,659	R277P	unknown	Het
Prf1	A	C	10: 61,300,437	D164A	probably damaging	Het
Rarres1	A	G	3: 67,479,591	V226A	probably damaging	Het
Rest	GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC	GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC	5: 77,281,804		probably benign	Het
Scnn1b	A	T	7: 121,912,103	T338S	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc9a5	T	C	8: 105,353,507	V94A	probably damaging	Het
Slco4a1	A	G	2: 180,464,685	D220G	probably benign	Het
Sult1c1	T	C	17: 53,962,172	D272G	possibly damaging	Het
Tgm1	T	C	14: 55,708,898	N427S	probably damaging	Het
Themis	C	A	10: 28,782,237	T420N	probably benign	Het
Tnni3	A	T	7: 4,518,377	F209L	probably damaging	Het
Ttn	T	A	2: 76,915,568	S5046C	probably damaging	Het
Tubb2a	T	A	13: 34,076,645	I24L	probably benign	Het
Uevld	C	A	7: 46,937,998	G318V	probably damaging	Het
Unkl	T	C	17: 25,229,376	S308P	probably benign	Het
Vmn1r159	C	A	7: 22,843,340	C89F	probably damaging	Het
Wee2	T	G	6: 40,461,043	S302A	probably benign	Het
Ydjc	T	C	16: 17,147,802	C144R	probably benign	Het
Zc3h12c	A	G	9: 52,116,119	S667P	probably benign	Het
Zfp280b	T	A	10: 76,038,817	Y177N	probably benign	Het
Zfp354b	C	T	11: 50,923,535	E188K	probably benign	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTGGGCTTTGCTGAAAG -3'
(R):5'- TGAGGAATGTGGTGTCAAAGCC -3'

Sequencing Primer
(F):5'- ATCATGGTGTCAGGAATATGTCAG -3'
(R):5'- AAAGCCTGGAGTTCTCTGCACAG -3'

Posted On

2022-02-07