Incidental Mutation 'R9171:Acad10'
ID 696395
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Name acyl-Coenzyme A dehydrogenase family, member 10
Synonyms 2410021P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9171 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121621026-121660514 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121629918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 823 (H823L)
Ref Sequence ENSEMBL: ENSMUSP00000031412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
AlphaFold Q8K370
Predicted Effect probably benign
Transcript: ENSMUST00000031412
AA Change: H823L

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: H823L

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111770
AA Change: H823L

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: H823L

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,869,116 T185S possibly damaging Het
Acly A G 11: 100,516,831 V231A probably benign Het
Adamts9 T C 6: 92,872,400 N1026S probably benign Het
Amot A T X: 145,461,749 L435H Het
Ankrd65 A G 4: 155,791,343 E7G probably benign Het
Ap1g2 T C 14: 55,099,124 H771R probably benign Het
Atp9a A G 2: 168,643,860 probably null Het
Atxn10 T G 15: 85,393,356 H341Q probably damaging Het
Cacng1 A G 11: 107,716,234 L53P probably damaging Het
Cdh23 T C 10: 60,326,031 N2014S probably benign Het
Cma1 T C 14: 55,943,732 N72S probably benign Het
Col7a1 G A 9: 108,978,885 G2551D unknown Het
Cyp20a1 T G 1: 60,376,184 L323R probably damaging Het
Dnah11 A T 12: 117,931,183 V3643E probably damaging Het
Dnmt3l A C 10: 78,059,684 D352A probably benign Het
Dock2 A T 11: 34,698,843 N462K probably benign Het
Drc1 A G 5: 30,356,450 Q450R probably benign Het
Eid3 C T 10: 82,867,482 T259M probably damaging Het
Eif2ak3 T G 6: 70,858,435 D115E probably damaging Het
Ezh2 A C 6: 47,554,200 D183E probably benign Het
Fam114a1 A C 5: 65,034,370 probably null Het
Fcho2 G A 13: 98,755,099 T385I probably benign Het
Gm11639 A G 11: 104,909,882 T2977A probably benign Het
Gm6882 C A 7: 21,427,329 E205* probably null Het
Hexim2 G A 11: 103,138,996 W291* probably null Het
Hnrnpab A C 11: 51,601,883 S265R unknown Het
Hsd17b1 A G 11: 101,079,006 N115D probably damaging Het
Ighmbp2 T C 19: 3,265,641 D593G possibly damaging Het
Inf2 C A 12: 112,601,531 C172* probably null Het
Invs A T 4: 48,398,149 N445I possibly damaging Het
Izumo2 A G 7: 44,719,760 Q186R probably benign Het
Kcnj15 T C 16: 95,296,622 F368L probably benign Het
Kctd20 A G 17: 28,966,892 D403G probably damaging Het
Kmt2c A C 5: 25,281,311 V4748G probably damaging Het
Lrrc37a A G 11: 103,502,314 S762P probably benign Het
Man2c1 C T 9: 57,137,033 Q324* probably null Het
Mgam A G 6: 40,768,212 I1804M possibly damaging Het
Mmp28 A G 11: 83,444,835 V279A probably benign Het
Mrpl22 T C 11: 58,179,359 V164A possibly damaging Het
Obscn A T 11: 59,061,503 H3913Q possibly damaging Het
Olfr150 C T 9: 39,737,220 T135I probably benign Het
Olfr49 T C 14: 54,282,872 T8A probably benign Het
Paqr6 A G 3: 88,365,759 T46A probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo2 T C 18: 63,045,479 D1789G probably benign Het
Pou4f2 T C 8: 78,436,119 T96A probably benign Het
Ppp1r12b A T 1: 134,873,987 V497E probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prrxl1 C T 14: 32,608,382 S152F probably damaging Het
Rsph4a C T 10: 33,909,442 Q450* probably null Het
Sh3d19 C T 3: 86,083,611 probably benign Het
Slc39a14 T C 14: 70,310,238 T259A probably benign Het
Snap91 T C 9: 86,798,619 T404A probably benign Het
Sptbn4 A T 7: 27,442,419 C50S possibly damaging Het
Stx8 A C 11: 67,984,645 N99H possibly damaging Het
Tgfbi A T 13: 56,625,713 M175L probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tle1 A T 4: 72,124,995 C536S possibly damaging Het
Tprn A G 2: 25,262,787 S34G probably benign Het
Vmn1r80 A T 7: 12,193,197 D78V possibly damaging Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1052:Acad10 UTSW 5 121649541 missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3824:Acad10 UTSW 5 121622818 missense probably benign
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5704:Acad10 UTSW 5 121631543 missense probably benign 0.03
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6384:Acad10 UTSW 5 121652003 missense probably benign 0.43
R6491:Acad10 UTSW 5 121630157 missense probably damaging 1.00
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
R8400:Acad10 UTSW 5 121626205 missense possibly damaging 0.82
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTAGAGATCTGCCTGCAGG -3'
(R):5'- TCTTGCTTTGCCATGACTGAG -3'

Sequencing Primer
(F):5'- CTGCAGGGGATCAGCCATAG -3'
(R):5'- AGCCTCAGGTACCATGTTTG -3'
Posted On 2022-02-07