Incidental Mutation 'R9171:Peg10'
ID 696396
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms HB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9171 (G1)
Quality Score 217.474
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GC to GCTCC at 4756452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,869,116 T185S possibly damaging Het
Acad10 T A 5: 121,629,918 H823L probably benign Het
Acly A G 11: 100,516,831 V231A probably benign Het
Adamts9 T C 6: 92,872,400 N1026S probably benign Het
Amot A T X: 145,461,749 L435H Het
Ankrd65 A G 4: 155,791,343 E7G probably benign Het
Ap1g2 T C 14: 55,099,124 H771R probably benign Het
Atp9a A G 2: 168,643,860 probably null Het
Atxn10 T G 15: 85,393,356 H341Q probably damaging Het
Cacng1 A G 11: 107,716,234 L53P probably damaging Het
Cdh23 T C 10: 60,326,031 N2014S probably benign Het
Cma1 T C 14: 55,943,732 N72S probably benign Het
Col7a1 G A 9: 108,978,885 G2551D unknown Het
Cyp20a1 T G 1: 60,376,184 L323R probably damaging Het
Dnah11 A T 12: 117,931,183 V3643E probably damaging Het
Dnmt3l A C 10: 78,059,684 D352A probably benign Het
Dock2 A T 11: 34,698,843 N462K probably benign Het
Drc1 A G 5: 30,356,450 Q450R probably benign Het
Eid3 C T 10: 82,867,482 T259M probably damaging Het
Eif2ak3 T G 6: 70,858,435 D115E probably damaging Het
Ezh2 A C 6: 47,554,200 D183E probably benign Het
Fam114a1 A C 5: 65,034,370 probably null Het
Fcho2 G A 13: 98,755,099 T385I probably benign Het
Gm11639 A G 11: 104,909,882 T2977A probably benign Het
Gm6882 C A 7: 21,427,329 E205* probably null Het
Hexim2 G A 11: 103,138,996 W291* probably null Het
Hnrnpab A C 11: 51,601,883 S265R unknown Het
Hsd17b1 A G 11: 101,079,006 N115D probably damaging Het
Ighmbp2 T C 19: 3,265,641 D593G possibly damaging Het
Inf2 C A 12: 112,601,531 C172* probably null Het
Invs A T 4: 48,398,149 N445I possibly damaging Het
Izumo2 A G 7: 44,719,760 Q186R probably benign Het
Kcnj15 T C 16: 95,296,622 F368L probably benign Het
Kctd20 A G 17: 28,966,892 D403G probably damaging Het
Kmt2c A C 5: 25,281,311 V4748G probably damaging Het
Lrrc37a A G 11: 103,502,314 S762P probably benign Het
Man2c1 C T 9: 57,137,033 Q324* probably null Het
Mgam A G 6: 40,768,212 I1804M possibly damaging Het
Mmp28 A G 11: 83,444,835 V279A probably benign Het
Mrpl22 T C 11: 58,179,359 V164A possibly damaging Het
Obscn A T 11: 59,061,503 H3913Q possibly damaging Het
Olfr150 C T 9: 39,737,220 T135I probably benign Het
Olfr49 T C 14: 54,282,872 T8A probably benign Het
Paqr6 A G 3: 88,365,759 T46A probably damaging Het
Piezo2 T C 18: 63,045,479 D1789G probably benign Het
Pou4f2 T C 8: 78,436,119 T96A probably benign Het
Ppp1r12b A T 1: 134,873,987 V497E probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prrxl1 C T 14: 32,608,382 S152F probably damaging Het
Rsph4a C T 10: 33,909,442 Q450* probably null Het
Sh3d19 C T 3: 86,083,611 probably benign Het
Slc39a14 T C 14: 70,310,238 T259A probably benign Het
Snap91 T C 9: 86,798,619 T404A probably benign Het
Sptbn4 A T 7: 27,442,419 C50S possibly damaging Het
Stx8 A C 11: 67,984,645 N99H possibly damaging Het
Tgfbi A T 13: 56,625,713 M175L probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tle1 A T 4: 72,124,995 C536S possibly damaging Het
Tprn A G 2: 25,262,787 S34G probably benign Het
Vmn1r80 A T 7: 12,193,197 D78V possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8354:Peg10 UTSW 6 4756452 small insertion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
R8408:Peg10 UTSW 6 4756453 small insertion probably benign
R8415:Peg10 UTSW 6 4756451 small insertion probably benign
R8439:Peg10 UTSW 6 4755462 missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4756398 small deletion probably benign
R8463:Peg10 UTSW 6 4756453 small insertion probably benign
R8477:Peg10 UTSW 6 4756453 small insertion probably benign
R8507:Peg10 UTSW 6 4756453 small insertion probably benign
R8552:Peg10 UTSW 6 4756452 small insertion probably benign
R8678:Peg10 UTSW 6 4756431 small deletion probably benign
R8699:Peg10 UTSW 6 4756451 small insertion probably benign
R8700:Peg10 UTSW 6 4756451 small insertion probably benign
R8705:Peg10 UTSW 6 4756398 small deletion probably benign
R8765:Peg10 UTSW 6 4754492 missense unknown
R8824:Peg10 UTSW 6 4756451 small insertion probably benign
R8859:Peg10 UTSW 6 4756451 small insertion probably benign
R8870:Peg10 UTSW 6 4754825 missense probably damaging 0.99
R8909:Peg10 UTSW 6 4756451 small insertion probably benign
R8918:Peg10 UTSW 6 4756398 small deletion probably benign
R8924:Peg10 UTSW 6 4756398 small deletion probably benign
R8925:Peg10 UTSW 6 4756452 small insertion probably benign
R8930:Peg10 UTSW 6 4756449 small insertion probably benign
R8950:Peg10 UTSW 6 4756452 small insertion probably benign
R8960:Peg10 UTSW 6 4756449 small insertion probably benign
R8975:Peg10 UTSW 6 4756452 small insertion probably benign
R8988:Peg10 UTSW 6 4756398 small deletion probably benign
R9046:Peg10 UTSW 6 4756452 small insertion probably benign
R9068:Peg10 UTSW 6 4756451 small insertion probably benign
R9074:Peg10 UTSW 6 4756451 small insertion probably benign
R9088:Peg10 UTSW 6 4756453 small insertion probably benign
R9094:Peg10 UTSW 6 4756449 small insertion probably benign
R9114:Peg10 UTSW 6 4756452 small insertion probably benign
R9116:Peg10 UTSW 6 4756452 small insertion probably benign
R9135:Peg10 UTSW 6 4756453 small insertion probably benign
R9137:Peg10 UTSW 6 4756398 small deletion probably benign
R9139:Peg10 UTSW 6 4756449 small insertion probably benign
R9139:Peg10 UTSW 6 4757128 missense unknown
R9173:Peg10 UTSW 6 4756451 small insertion probably benign
R9213:Peg10 UTSW 6 4756451 small insertion probably benign
R9216:Peg10 UTSW 6 4756452 small insertion probably benign
R9229:Peg10 UTSW 6 4756398 small deletion probably benign
R9233:Peg10 UTSW 6 4756398 small deletion probably benign
R9283:Peg10 UTSW 6 4756452 small insertion probably benign
R9328:Peg10 UTSW 6 4756398 small deletion probably benign
R9367:Peg10 UTSW 6 4756398 small deletion probably benign
R9369:Peg10 UTSW 6 4756452 small insertion probably benign
R9405:Peg10 UTSW 6 4756398 small deletion probably benign
R9410:Peg10 UTSW 6 4756452 small insertion probably benign
R9412:Peg10 UTSW 6 4756453 small insertion probably benign
R9421:Peg10 UTSW 6 4756398 small deletion probably benign
R9437:Peg10 UTSW 6 4756451 small insertion probably benign
R9440:Peg10 UTSW 6 4756451 small insertion probably benign
R9460:Peg10 UTSW 6 4756452 small insertion probably benign
R9492:Peg10 UTSW 6 4756398 small deletion probably benign
R9495:Peg10 UTSW 6 4756451 small insertion probably benign
R9500:Peg10 UTSW 6 4756871 missense unknown
R9511:Peg10 UTSW 6 4756451 small insertion probably benign
R9515:Peg10 UTSW 6 4756452 small insertion probably benign
R9576:Peg10 UTSW 6 4756398 small deletion probably benign
R9610:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756453 small insertion probably benign
R9614:Peg10 UTSW 6 4756451 small insertion probably benign
R9619:Peg10 UTSW 6 4755316 missense probably benign 0.02
R9646:Peg10 UTSW 6 4756452 small insertion probably benign
R9655:Peg10 UTSW 6 4756398 small deletion probably benign
R9673:Peg10 UTSW 6 4756452 small insertion probably benign
R9675:Peg10 UTSW 6 4756398 small deletion probably benign
R9696:Peg10 UTSW 6 4756431 small deletion probably benign
R9749:Peg10 UTSW 6 4756398 small deletion probably benign
R9756:Peg10 UTSW 6 4756452 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On 2022-02-07