Incidental Mutation 'R9171:Peg10'
ID 696396
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms MEF3L, MyEF-3 like, Rtl2, Mar2, MyEF-3, HB-1, Edr, Mart2
MMRRC Submission 068976-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9171 (G1)
Quality Score 217.474
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GC to GCTCC at 4756452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,732,512 (GRCm39) T185S possibly damaging Het
Acad10 T A 5: 121,767,981 (GRCm39) H823L probably benign Het
Acly A G 11: 100,407,657 (GRCm39) V231A probably benign Het
Adamts9 T C 6: 92,849,381 (GRCm39) N1026S probably benign Het
Amot A T X: 144,244,745 (GRCm39) L435H Het
Ankrd65 A G 4: 155,875,800 (GRCm39) E7G probably benign Het
Ap1g2 T C 14: 55,336,581 (GRCm39) H771R probably benign Het
Atp9a A G 2: 168,485,780 (GRCm39) probably null Het
Atxn10 T G 15: 85,277,557 (GRCm39) H341Q probably damaging Het
Cacng1 A G 11: 107,607,060 (GRCm39) L53P probably damaging Het
Cdh23 T C 10: 60,161,810 (GRCm39) N2014S probably benign Het
Cma1 T C 14: 56,181,189 (GRCm39) N72S probably benign Het
Col7a1 G A 9: 108,807,953 (GRCm39) G2551D unknown Het
Cyp20a1 T G 1: 60,415,343 (GRCm39) L323R probably damaging Het
Dnah11 A T 12: 117,894,918 (GRCm39) V3643E probably damaging Het
Dnmt3l A C 10: 77,895,518 (GRCm39) D352A probably benign Het
Dock2 A T 11: 34,589,670 (GRCm39) N462K probably benign Het
Drc1 A G 5: 30,513,794 (GRCm39) Q450R probably benign Het
Drgx C T 14: 32,330,339 (GRCm39) S152F probably damaging Het
Efcab3 A G 11: 104,800,708 (GRCm39) T2977A probably benign Het
Eid3 C T 10: 82,703,316 (GRCm39) T259M probably damaging Het
Eif2ak3 T G 6: 70,835,419 (GRCm39) D115E probably damaging Het
Ezh2 A C 6: 47,531,134 (GRCm39) D183E probably benign Het
Fam114a1 A C 5: 65,191,713 (GRCm39) probably null Het
Fcho2 G A 13: 98,891,607 (GRCm39) T385I probably benign Het
Gm6882 C A 7: 21,161,254 (GRCm39) E205* probably null Het
Hexim2 G A 11: 103,029,822 (GRCm39) W291* probably null Het
Hnrnpab A C 11: 51,492,710 (GRCm39) S265R unknown Het
Hsd17b1 A G 11: 100,969,832 (GRCm39) N115D probably damaging Het
Ighmbp2 T C 19: 3,315,641 (GRCm39) D593G possibly damaging Het
Inf2 C A 12: 112,567,965 (GRCm39) C172* probably null Het
Invs A T 4: 48,398,149 (GRCm39) N445I possibly damaging Het
Izumo2 A G 7: 44,369,184 (GRCm39) Q186R probably benign Het
Kcnj15 T C 16: 95,097,481 (GRCm39) F368L probably benign Het
Kctd20 A G 17: 29,185,866 (GRCm39) D403G probably damaging Het
Kmt2c A C 5: 25,486,309 (GRCm39) V4748G probably damaging Het
Lrrc37a A G 11: 103,393,140 (GRCm39) S762P probably benign Het
Man2c1 C T 9: 57,044,317 (GRCm39) Q324* probably null Het
Mgam A G 6: 40,745,146 (GRCm39) I1804M possibly damaging Het
Mmp28 A G 11: 83,335,661 (GRCm39) V279A probably benign Het
Mrpl22 T C 11: 58,070,185 (GRCm39) V164A possibly damaging Het
Obscn A T 11: 58,952,329 (GRCm39) H3913Q possibly damaging Het
Or6e1 T C 14: 54,520,329 (GRCm39) T8A probably benign Het
Or8g50 C T 9: 39,648,516 (GRCm39) T135I probably benign Het
Paqr6 A G 3: 88,273,066 (GRCm39) T46A probably damaging Het
Piezo2 T C 18: 63,178,550 (GRCm39) D1789G probably benign Het
Pou4f2 T C 8: 79,162,748 (GRCm39) T96A probably benign Het
Ppp1r12b A T 1: 134,801,725 (GRCm39) V497E probably benign Het
Prdm13 C G 4: 21,679,659 (GRCm39) R277P unknown Het
Rsph4a C T 10: 33,785,438 (GRCm39) Q450* probably null Het
Sh3d19 C T 3: 85,990,918 (GRCm39) probably benign Het
Slc39a14 T C 14: 70,547,687 (GRCm39) T259A probably benign Het
Snap91 T C 9: 86,680,672 (GRCm39) T404A probably benign Het
Sptbn4 A T 7: 27,141,844 (GRCm39) C50S possibly damaging Het
Stx8 A C 11: 67,875,471 (GRCm39) N99H possibly damaging Het
Tgfbi A T 13: 56,773,526 (GRCm39) M175L probably damaging Het
Themis C A 10: 28,658,233 (GRCm39) T420N probably benign Het
Tle1 A T 4: 72,043,232 (GRCm39) C536S possibly damaging Het
Tprn A G 2: 25,152,799 (GRCm39) S34G probably benign Het
Vmn1r80 A T 7: 11,927,124 (GRCm39) D78V possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4,754,473 (GRCm39) utr 5 prime probably benign
IGL03063:Peg10 APN 6 4,756,647 (GRCm39) utr 3 prime probably benign
piaggio UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4,756,560 (GRCm39) missense unknown
R0090:Peg10 UTSW 6 4,756,063 (GRCm39) utr 3 prime probably benign
R0148:Peg10 UTSW 6 4,755,711 (GRCm39) missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4,756,475 (GRCm39) small insertion probably benign
R0698:Peg10 UTSW 6 4,756,835 (GRCm39) utr 3 prime probably benign
R1600:Peg10 UTSW 6 4,757,080 (GRCm39) utr 3 prime probably benign
R1842:Peg10 UTSW 6 4,756,381 (GRCm39) utr 3 prime probably benign
R1930:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R1931:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R2162:Peg10 UTSW 6 4,755,914 (GRCm39) utr 3 prime probably benign
R2215:Peg10 UTSW 6 4,756,918 (GRCm39) utr 3 prime probably benign
R2339:Peg10 UTSW 6 4,756,102 (GRCm39) utr 3 prime probably benign
R2847:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R2848:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R3000:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R3056:Peg10 UTSW 6 4,755,029 (GRCm39) missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4,754,534 (GRCm39) missense probably benign 0.00
R4059:Peg10 UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
R4296:Peg10 UTSW 6 4,756,472 (GRCm39) small insertion probably benign
R4626:Peg10 UTSW 6 4,756,460 (GRCm39) small insertion probably benign
R4634:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4679:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4834:Peg10 UTSW 6 4,754,294 (GRCm39) utr 5 prime probably benign
R4982:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4983:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4996:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R4997:Peg10 UTSW 6 4,756,457 (GRCm39) small insertion probably benign
R5015:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5085:Peg10 UTSW 6 4,755,864 (GRCm39) utr 3 prime probably benign
R5091:Peg10 UTSW 6 4,754,511 (GRCm39) missense probably benign 0.01
R5231:Peg10 UTSW 6 4,756,939 (GRCm39) utr 3 prime probably benign
R5278:Peg10 UTSW 6 4,756,442 (GRCm39) small deletion probably benign
R5364:Peg10 UTSW 6 4,756,128 (GRCm39) utr 3 prime probably benign
R5397:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5485:Peg10 UTSW 6 4,755,565 (GRCm39) missense probably benign 0.09
R5573:Peg10 UTSW 6 4,755,913 (GRCm39) utr 3 prime probably benign
R5710:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R5710:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R5736:Peg10 UTSW 6 4,754,423 (GRCm39) missense probably benign 0.00
R5865:Peg10 UTSW 6 4,754,375 (GRCm39) missense probably damaging 0.98
R6056:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6116:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6129:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6147:Peg10 UTSW 6 4,754,499 (GRCm39) start gained probably benign
R6171:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6194:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6197:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6207:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6215:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6276:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6281:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6287:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6302:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6393:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6394:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6405:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R6421:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6486:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6538:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6668:Peg10 UTSW 6 4,754,502 (GRCm39) missense probably benign 0.01
R6679:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R6685:Peg10 UTSW 6 4,754,738 (GRCm39) missense probably damaging 1.00
R6702:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6706:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6747:Peg10 UTSW 6 4,757,137 (GRCm39) utr 3 prime probably benign
R6775:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6811:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6823:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6826:Peg10 UTSW 6 4,756,353 (GRCm39) small insertion probably benign
R6847:Peg10 UTSW 6 4,754,279 (GRCm39) utr 5 prime probably benign
R6861:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6861:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R6876:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6891:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6911:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6973:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6990:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6998:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7070:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7120:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7132:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7140:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7189:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7208:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7256:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7260:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7261:Peg10 UTSW 6 4,756,591 (GRCm39) missense unknown
R7401:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7409:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7439:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7475:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7483:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7502:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7520:Peg10 UTSW 6 4,756,796 (GRCm39) missense unknown
R7544:Peg10 UTSW 6 4,756,427 (GRCm39) frame shift probably null
R7571:Peg10 UTSW 6 4,756,082 (GRCm39) missense unknown
R7581:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7635:Peg10 UTSW 6 4,754,938 (GRCm39) missense probably damaging 0.99
R7677:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7697:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7710:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7803:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7816:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7820:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7827:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7861:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7881:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7904:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7915:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7916:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7963:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8016:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8037:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8062:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8081:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8113:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8115:Peg10 UTSW 6 4,756,707 (GRCm39) missense unknown
R8140:Peg10 UTSW 6 4,756,113 (GRCm39) missense unknown
R8178:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8233:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8239:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8281:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8310:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R8312:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8330:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8338:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8354:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8387:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8390:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8408:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8415:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8439:Peg10 UTSW 6 4,755,462 (GRCm39) missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8463:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8477:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8507:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8552:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8678:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8699:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8700:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8705:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8765:Peg10 UTSW 6 4,754,492 (GRCm39) missense unknown
R8824:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8859:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8870:Peg10 UTSW 6 4,754,825 (GRCm39) missense probably damaging 0.99
R8909:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8918:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8924:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8925:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8930:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8950:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8960:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8975:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8988:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9046:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9068:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9074:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9088:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9094:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9114:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9116:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9135:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9137:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9139:Peg10 UTSW 6 4,757,128 (GRCm39) missense unknown
R9139:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9173:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9213:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9216:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9229:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9233:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9283:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9328:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9367:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9369:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9405:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9410:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9412:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9421:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9437:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9440:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9460:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9492:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9495:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9500:Peg10 UTSW 6 4,756,871 (GRCm39) missense unknown
R9511:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9576:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9610:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9614:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9619:Peg10 UTSW 6 4,755,316 (GRCm39) missense probably benign 0.02
R9646:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9655:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9673:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9675:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9696:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R9749:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9756:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
X0065:Peg10 UTSW 6 4,756,515 (GRCm39) utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On 2022-02-07