Incidental Mutation 'R9171:Mgam'
ID 696397
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R9171 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40768212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1804 (I1804M)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071535
AA Change: I1804M

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: I1804M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201148
AA Change: I1804M

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: I1804M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202779
AA Change: I1177M

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: I1177M

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,869,116 T185S possibly damaging Het
Acad10 T A 5: 121,629,918 H823L probably benign Het
Acly A G 11: 100,516,831 V231A probably benign Het
Adamts9 T C 6: 92,872,400 N1026S probably benign Het
Amot A T X: 145,461,749 L435H Het
Ankrd65 A G 4: 155,791,343 E7G probably benign Het
Ap1g2 T C 14: 55,099,124 H771R probably benign Het
Atp9a A G 2: 168,643,860 probably null Het
Atxn10 T G 15: 85,393,356 H341Q probably damaging Het
Cacng1 A G 11: 107,716,234 L53P probably damaging Het
Cdh23 T C 10: 60,326,031 N2014S probably benign Het
Cma1 T C 14: 55,943,732 N72S probably benign Het
Col7a1 G A 9: 108,978,885 G2551D unknown Het
Cyp20a1 T G 1: 60,376,184 L323R probably damaging Het
Dnah11 A T 12: 117,931,183 V3643E probably damaging Het
Dnmt3l A C 10: 78,059,684 D352A probably benign Het
Dock2 A T 11: 34,698,843 N462K probably benign Het
Drc1 A G 5: 30,356,450 Q450R probably benign Het
Eid3 C T 10: 82,867,482 T259M probably damaging Het
Eif2ak3 T G 6: 70,858,435 D115E probably damaging Het
Ezh2 A C 6: 47,554,200 D183E probably benign Het
Fam114a1 A C 5: 65,034,370 probably null Het
Fcho2 G A 13: 98,755,099 T385I probably benign Het
Gm11639 A G 11: 104,909,882 T2977A probably benign Het
Gm6882 C A 7: 21,427,329 E205* probably null Het
Hexim2 G A 11: 103,138,996 W291* probably null Het
Hnrnpab A C 11: 51,601,883 S265R unknown Het
Hsd17b1 A G 11: 101,079,006 N115D probably damaging Het
Ighmbp2 T C 19: 3,265,641 D593G possibly damaging Het
Inf2 C A 12: 112,601,531 C172* probably null Het
Invs A T 4: 48,398,149 N445I possibly damaging Het
Izumo2 A G 7: 44,719,760 Q186R probably benign Het
Kcnj15 T C 16: 95,296,622 F368L probably benign Het
Kctd20 A G 17: 28,966,892 D403G probably damaging Het
Kmt2c A C 5: 25,281,311 V4748G probably damaging Het
Lrrc37a A G 11: 103,502,314 S762P probably benign Het
Man2c1 C T 9: 57,137,033 Q324* probably null Het
Mmp28 A G 11: 83,444,835 V279A probably benign Het
Mrpl22 T C 11: 58,179,359 V164A possibly damaging Het
Obscn A T 11: 59,061,503 H3913Q possibly damaging Het
Olfr150 C T 9: 39,737,220 T135I probably benign Het
Olfr49 T C 14: 54,282,872 T8A probably benign Het
Paqr6 A G 3: 88,365,759 T46A probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo2 T C 18: 63,045,479 D1789G probably benign Het
Pou4f2 T C 8: 78,436,119 T96A probably benign Het
Ppp1r12b A T 1: 134,873,987 V497E probably benign Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prrxl1 C T 14: 32,608,382 S152F probably damaging Het
Rsph4a C T 10: 33,909,442 Q450* probably null Het
Sh3d19 C T 3: 86,083,611 probably benign Het
Slc39a14 T C 14: 70,310,238 T259A probably benign Het
Snap91 T C 9: 86,798,619 T404A probably benign Het
Sptbn4 A T 7: 27,442,419 C50S possibly damaging Het
Stx8 A C 11: 67,984,645 N99H possibly damaging Het
Tgfbi A T 13: 56,625,713 M175L probably damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tle1 A T 4: 72,124,995 C536S possibly damaging Het
Tprn A G 2: 25,262,787 S34G probably benign Het
Vmn1r80 A T 7: 12,193,197 D78V possibly damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGTTGTGCATGGAATC -3'
(R):5'- GGAGCTGCCATGACAAGATTTC -3'

Sequencing Primer
(F):5'- GTGCATGGAATCATTCTTATCACAG -3'
(R):5'- AGCTGCCATGACAAGATTTCTGTTG -3'
Posted On 2022-02-07