Incidental Mutation 'R9172:Semp2l1'
ID 696443
Institutional Source Beutler Lab
Gene Symbol Semp2l1
Ensembl Gene ENSMUSG00000091318
Gene Name SUMO/sentrin specific peptidase 2-like 1
Synonyms Gm5415
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 32582767-32586375 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32585165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 248 (H248Q)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
AlphaFold E9PXF3
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171322
AA Change: H248Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: H248Q

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Semp2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Semp2l1 APN 1 32,585,748 (GRCm39) missense probably benign
IGL01148:Semp2l1 APN 1 32,584,735 (GRCm39) missense possibly damaging 0.88
IGL02323:Semp2l1 APN 1 32,584,785 (GRCm39) nonsense probably null
IGL03076:Semp2l1 APN 1 32,584,626 (GRCm39) missense probably damaging 1.00
IGL03288:Semp2l1 APN 1 32,584,841 (GRCm39) missense probably benign 0.09
PIT4576001:Semp2l1 UTSW 1 32,585,553 (GRCm39) missense probably damaging 1.00
R0110:Semp2l1 UTSW 1 32,584,956 (GRCm39) missense possibly damaging 0.87
R0510:Semp2l1 UTSW 1 32,584,956 (GRCm39) missense possibly damaging 0.87
R0891:Semp2l1 UTSW 1 32,585,442 (GRCm39) missense possibly damaging 0.54
R1836:Semp2l1 UTSW 1 32,584,758 (GRCm39) missense probably damaging 1.00
R1939:Semp2l1 UTSW 1 32,584,627 (GRCm39) missense probably damaging 0.99
R2156:Semp2l1 UTSW 1 32,585,128 (GRCm39) missense probably benign 0.08
R2226:Semp2l1 UTSW 1 32,584,934 (GRCm39) missense probably damaging 1.00
R2422:Semp2l1 UTSW 1 32,584,942 (GRCm39) missense possibly damaging 0.73
R4761:Semp2l1 UTSW 1 32,585,588 (GRCm39) missense possibly damaging 0.51
R4901:Semp2l1 UTSW 1 32,585,701 (GRCm39) missense probably benign 0.00
R5129:Semp2l1 UTSW 1 32,584,561 (GRCm39) missense probably damaging 1.00
R5129:Semp2l1 UTSW 1 32,584,560 (GRCm39) missense probably damaging 1.00
R5184:Semp2l1 UTSW 1 32,584,729 (GRCm39) missense probably damaging 0.99
R5259:Semp2l1 UTSW 1 32,584,598 (GRCm39) nonsense probably null
R6271:Semp2l1 UTSW 1 32,584,572 (GRCm39) missense probably damaging 1.00
R6589:Semp2l1 UTSW 1 32,585,792 (GRCm39) missense probably benign 0.44
R6746:Semp2l1 UTSW 1 32,585,844 (GRCm39) missense probably benign
R7720:Semp2l1 UTSW 1 32,585,178 (GRCm39) missense probably benign 0.00
R7855:Semp2l1 UTSW 1 32,585,114 (GRCm39) missense probably damaging 0.96
R8006:Semp2l1 UTSW 1 32,586,005 (GRCm39) start gained probably benign
R8177:Semp2l1 UTSW 1 32,585,457 (GRCm39) missense probably benign
R8946:Semp2l1 UTSW 1 32,585,685 (GRCm39) missense probably benign 0.02
R9455:Semp2l1 UTSW 1 32,585,907 (GRCm39) start codon destroyed probably null
X0024:Semp2l1 UTSW 1 32,584,792 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACCTCATCATTGAGCCACTG -3'
(R):5'- ACTGTTGTGGCTCTAAAAGAATGTC -3'

Sequencing Primer
(F):5'- GAGCCACTGACCATTCTTCAGG -3'
(R):5'- ATGTCTTTCACCAGACGAGAG -3'
Posted On 2022-02-07