Incidental Mutation 'R9172:Cry2'
ID 696446
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome 2 (photolyase-like)
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 92403646-92434043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92413648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 393 (E393D)
Ref Sequence ENSEMBL: ENSMUSP00000088047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
PDB Structure A vertebrate cryptochrome [X-RAY DIFFRACTION]
a vertebrate cryptochrome with FAD [X-RAY DIFFRACTION]
A ubiquitin ligase-substrate complex [X-RAY DIFFRACTION]
Mammalian cryptochrome in complex with a small molecule competitor of its ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of Mammalian Period-Cryptochrome Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000090559
AA Change: E393D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: E393D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111278
AA Change: E393D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: E393D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,454 K159E probably benign Het
Accsl A T 2: 93,861,488 L332Q probably damaging Het
Adcy1 A G 11: 7,160,317 N855D probably damaging Het
Adgrl3 T A 5: 81,774,404 C1199S probably benign Het
Alyref G A 11: 120,596,016 R140C probably benign Het
Arhgap26 A T 18: 39,245,329 I92F probably damaging Het
Atp9b G A 18: 80,917,778 R73* probably null Het
Btaf1 G A 19: 37,000,230 A1483T probably damaging Het
Casc1 A G 6: 145,177,449 F564L probably benign Het
Cmtr2 T C 8: 110,222,129 L357P probably damaging Het
Commd7 A T 2: 153,628,554 L51Q possibly damaging Het
Cpd T A 11: 76,784,426 I1290L probably benign Het
Ctsm A T 13: 61,537,829 M74K Het
Dync2h1 T C 9: 7,031,771 Y3491C probably damaging Het
Erc1 A C 6: 119,824,881 N58K possibly damaging Het
Fbxw21 T C 9: 109,146,696 T211A probably benign Het
Fry T C 5: 150,413,328 V1388A probably benign Het
Fuk A G 8: 110,883,925 W949R probably damaging Het
Gca T G 2: 62,690,024 I176S probably damaging Het
Gimap7 A T 6: 48,723,827 K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5415 G T 1: 32,546,084 H248Q probably benign Het
Gm906 A G 13: 50,247,381 F303S probably benign Het
Gm9195 A C 14: 72,473,714 L428R probably damaging Het
Grin2b A G 6: 135,779,257 I490T possibly damaging Het
Kif24 T C 4: 41,400,442 T499A probably benign Het
Mbtps1 G A 8: 119,533,369 T413I probably damaging Het
Med4 A T 14: 73,513,925 S105C probably benign Het
Mgat1 G A 11: 49,261,083 R131Q probably damaging Het
Mroh4 T C 15: 74,606,112 *984W probably null Het
Mybpc1 T C 10: 88,543,753 E628G possibly damaging Het
Myh8 C T 11: 67,292,434 P713L possibly damaging Het
Myo7a T C 7: 98,083,162 D706G probably benign Het
Nbas T A 12: 13,374,750 C997S possibly damaging Het
Nkx2-1 C A 12: 56,534,967 G32C probably damaging Het
Npas3 A G 12: 54,065,870 T466A probably benign Het
Olfr1085 T A 2: 86,657,535 I308L probably benign Het
Olfr487 T C 7: 108,211,962 E189G probably benign Het
Opa1 C T 16: 29,620,414 R683C probably benign Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Ppfibp2 T A 7: 107,738,318 L609* probably null Het
Pygo2 T A 3: 89,433,310 D338E possibly damaging Het
Pzp A T 6: 128,525,209 M59K probably benign Het
Reln A G 5: 21,950,817 probably null Het
Ripor1 A G 8: 105,621,201 D1097G unknown Het
Rmdn3 T C 2: 119,138,382 K443E probably benign Het
Rnf145 A G 11: 44,557,435 D373G possibly damaging Het
Sec23b A T 2: 144,559,259 E13D probably benign Het
Slc39a6 A G 18: 24,582,342 F707S probably damaging Het
Sox11 G A 12: 27,341,537 A291V possibly damaging Het
Spg20 T A 3: 55,124,846 V367D possibly damaging Het
Strap A T 6: 137,741,367 K156N probably benign Het
Stxbp5 T A 10: 9,769,408 I951F possibly damaging Het
Taar7a T C 10: 23,992,779 I235V probably benign Het
Tek T A 4: 94,804,346 N230K probably benign Het
Tyw1 T A 5: 130,296,679 C469* probably null Het
Vcan T C 13: 89,679,931 H3132R probably damaging Het
Vmn2r24 A G 6: 123,806,473 D544G probably damaging Het
Vmn2r3 A T 3: 64,278,982 M94K possibly damaging Het
Vps33a T C 5: 123,536,541 T388A probably benign Het
Vta1 A G 10: 14,675,999 I152T probably damaging Het
Vtcn1 A G 3: 100,892,549 D242G probably benign Het
Zfp12 T A 5: 143,245,465 C548S probably damaging Het
Zfp263 A G 16: 3,749,459 D546G probably benign Het
Zfp324 T A 7: 12,970,762 C293S probably damaging Het
Zscan4c A T 7: 11,009,892 I473F possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
R8234:Cry2 UTSW 2 92412629 missense probably benign
R8350:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8450:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8496:Cry2 UTSW 2 92426939 missense probably damaging 1.00
R9283:Cry2 UTSW 2 92413904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACACTATTACACCCTCAGGG -3'
(R):5'- TTCTTCTACACAGCGGCCAC -3'

Sequencing Primer
(F):5'- TCAGGGAGCCAGAGCCC -3'
(R):5'- ACCCCAGGTTTGACCGAATG -3'
Posted On 2022-02-07