Incidental Mutation 'R9172:Commd7'
ID 696450
Institutional Source Beutler Lab
Gene Symbol Commd7
Ensembl Gene ENSMUSG00000056941
Gene Name COMM domain containing 7
Synonyms mU3, 2310010I22Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.243) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 153458853-153474701 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 153470474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 51 (L51Q)
Ref Sequence ENSEMBL: ENSMUSP00000071752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071852] [ENSMUST00000109782]
AlphaFold Q8BG94
Predicted Effect possibly damaging
Transcript: ENSMUST00000071852
AA Change: L51Q

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071752
Gene: ENSMUSG00000056941
AA Change: L51Q

DomainStartEndE-ValueType
Pfam:HCaRG 19 199 3.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109782
SMART Domains Protein: ENSMUSP00000105404
Gene: ENSMUSG00000056941

DomainStartEndE-ValueType
Pfam:HCaRG 1 127 4.4e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Commd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03392:Commd7 APN 2 153,464,684 (GRCm39) splice site probably benign
R1065:Commd7 UTSW 2 153,461,447 (GRCm39) splice site probably benign
R1131:Commd7 UTSW 2 153,464,047 (GRCm39) missense probably benign 0.00
R2132:Commd7 UTSW 2 153,463,586 (GRCm39) intron probably benign
R3897:Commd7 UTSW 2 153,464,710 (GRCm39) missense probably benign
R5837:Commd7 UTSW 2 153,471,144 (GRCm39) missense possibly damaging 0.79
R5902:Commd7 UTSW 2 153,463,737 (GRCm39) missense probably damaging 1.00
R6207:Commd7 UTSW 2 153,474,530 (GRCm39) missense possibly damaging 0.73
R9573:Commd7 UTSW 2 153,463,981 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTCTGGCTATTTACTGCTC -3'
(R):5'- TGCAAGCAGAATACTCAGGC -3'

Sequencing Primer
(F):5'- CCTGTGACTCTCTAACTAAAGGAAGG -3'
(R):5'- GGGCTTCAGATCCCATTACAGATG -3'
Posted On 2022-02-07