Incidental Mutation 'R9172:Reln'
ID 696457
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 21950817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062372
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161356
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,454 K159E probably benign Het
Accsl A T 2: 93,861,488 L332Q probably damaging Het
Adcy1 A G 11: 7,160,317 N855D probably damaging Het
Adgrl3 T A 5: 81,774,404 C1199S probably benign Het
Alyref G A 11: 120,596,016 R140C probably benign Het
Arhgap26 A T 18: 39,245,329 I92F probably damaging Het
Atp9b G A 18: 80,917,778 R73* probably null Het
Btaf1 G A 19: 37,000,230 A1483T probably damaging Het
Casc1 A G 6: 145,177,449 F564L probably benign Het
Cmtr2 T C 8: 110,222,129 L357P probably damaging Het
Commd7 A T 2: 153,628,554 L51Q possibly damaging Het
Cpd T A 11: 76,784,426 I1290L probably benign Het
Cry2 C A 2: 92,413,648 E393D probably damaging Het
Ctsm A T 13: 61,537,829 M74K Het
Dync2h1 T C 9: 7,031,771 Y3491C probably damaging Het
Erc1 A C 6: 119,824,881 N58K possibly damaging Het
Fbxw21 T C 9: 109,146,696 T211A probably benign Het
Fry T C 5: 150,413,328 V1388A probably benign Het
Fuk A G 8: 110,883,925 W949R probably damaging Het
Gca T G 2: 62,690,024 I176S probably damaging Het
Gimap7 A T 6: 48,723,827 K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5415 G T 1: 32,546,084 H248Q probably benign Het
Gm906 A G 13: 50,247,381 F303S probably benign Het
Gm9195 A C 14: 72,473,714 L428R probably damaging Het
Grin2b A G 6: 135,779,257 I490T possibly damaging Het
Kif24 T C 4: 41,400,442 T499A probably benign Het
Mbtps1 G A 8: 119,533,369 T413I probably damaging Het
Med4 A T 14: 73,513,925 S105C probably benign Het
Mgat1 G A 11: 49,261,083 R131Q probably damaging Het
Mroh4 T C 15: 74,606,112 *984W probably null Het
Mybpc1 T C 10: 88,543,753 E628G possibly damaging Het
Myh8 C T 11: 67,292,434 P713L possibly damaging Het
Myo7a T C 7: 98,083,162 D706G probably benign Het
Nbas T A 12: 13,374,750 C997S possibly damaging Het
Nkx2-1 C A 12: 56,534,967 G32C probably damaging Het
Npas3 A G 12: 54,065,870 T466A probably benign Het
Olfr1085 T A 2: 86,657,535 I308L probably benign Het
Olfr487 T C 7: 108,211,962 E189G probably benign Het
Opa1 C T 16: 29,620,414 R683C probably benign Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Ppfibp2 T A 7: 107,738,318 L609* probably null Het
Pygo2 T A 3: 89,433,310 D338E possibly damaging Het
Pzp A T 6: 128,525,209 M59K probably benign Het
Ripor1 A G 8: 105,621,201 D1097G unknown Het
Rmdn3 T C 2: 119,138,382 K443E probably benign Het
Rnf145 A G 11: 44,557,435 D373G possibly damaging Het
Sec23b A T 2: 144,559,259 E13D probably benign Het
Slc39a6 A G 18: 24,582,342 F707S probably damaging Het
Sox11 G A 12: 27,341,537 A291V possibly damaging Het
Spg20 T A 3: 55,124,846 V367D possibly damaging Het
Strap A T 6: 137,741,367 K156N probably benign Het
Stxbp5 T A 10: 9,769,408 I951F possibly damaging Het
Taar7a T C 10: 23,992,779 I235V probably benign Het
Tek T A 4: 94,804,346 N230K probably benign Het
Tyw1 T A 5: 130,296,679 C469* probably null Het
Vcan T C 13: 89,679,931 H3132R probably damaging Het
Vmn2r24 A G 6: 123,806,473 D544G probably damaging Het
Vmn2r3 A T 3: 64,278,982 M94K possibly damaging Het
Vps33a T C 5: 123,536,541 T388A probably benign Het
Vta1 A G 10: 14,675,999 I152T probably damaging Het
Vtcn1 A G 3: 100,892,549 D242G probably benign Het
Zfp12 T A 5: 143,245,465 C548S probably damaging Het
Zfp263 A G 16: 3,749,459 D546G probably benign Het
Zfp324 T A 7: 12,970,762 C293S probably damaging Het
Zscan4c A T 7: 11,009,892 I473F possibly damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
Fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22286896 missense possibly damaging 0.71
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
R7085:Reln UTSW 5 21915087 nonsense probably null
R7091:Reln UTSW 5 21899029 missense probably null 0.08
R7135:Reln UTSW 5 21976596 missense possibly damaging 0.95
R7146:Reln UTSW 5 22106097 missense probably damaging 0.97
R7167:Reln UTSW 5 21942620 missense probably damaging 1.00
R7190:Reln UTSW 5 22047947 missense probably damaging 1.00
R7256:Reln UTSW 5 21978923 missense probably benign 0.03
R7393:Reln UTSW 5 21976351 missense probably damaging 0.99
R7399:Reln UTSW 5 22051367 missense probably damaging 0.99
R7400:Reln UTSW 5 21971934 missense probably damaging 0.99
R7426:Reln UTSW 5 21971953 missense probably damaging 1.00
R7463:Reln UTSW 5 22103435 missense probably damaging 0.98
R7470:Reln UTSW 5 21942741 missense probably damaging 0.99
R7473:Reln UTSW 5 21929127 missense probably benign 0.25
R7501:Reln UTSW 5 22227638 missense possibly damaging 0.91
R7542:Reln UTSW 5 21955181 missense probably damaging 1.00
R7544:Reln UTSW 5 21976278 nonsense probably null
R7588:Reln UTSW 5 21885568 missense probably benign 0.03
R7631:Reln UTSW 5 21971935 missense probably damaging 0.97
R7644:Reln UTSW 5 21978931 missense probably benign 0.39
R7834:Reln UTSW 5 22039635 missense possibly damaging 0.94
R7923:Reln UTSW 5 22134692 missense probably benign 0.00
R7938:Reln UTSW 5 21950872 missense probably damaging 0.97
R8006:Reln UTSW 5 21899084 nonsense probably null
R8062:Reln UTSW 5 21971992 missense probably benign 0.00
R8222:Reln UTSW 5 21931477 nonsense probably null
R8266:Reln UTSW 5 22018087 missense possibly damaging 0.62
R8267:Reln UTSW 5 22004112 missense probably damaging 1.00
R8487:Reln UTSW 5 21899029 missense probably benign 0.03
R8523:Reln UTSW 5 22004231 missense probably damaging 1.00
R8751:Reln UTSW 5 21942674 missense probably benign 0.37
R8801:Reln UTSW 5 21950856 missense possibly damaging 0.94
R8802:Reln UTSW 5 21925259 missense probably damaging 0.98
R8978:Reln UTSW 5 21885514 missense possibly damaging 0.85
R8988:Reln UTSW 5 21899157 missense probably damaging 0.97
R8995:Reln UTSW 5 21979579 missense probably benign 0.00
R9022:Reln UTSW 5 21976615 missense possibly damaging 0.66
R9042:Reln UTSW 5 22048038 missense probably damaging 1.00
R9069:Reln UTSW 5 22011061 missense probably damaging 1.00
R9089:Reln UTSW 5 21925200 missense probably benign 0.01
R9126:Reln UTSW 5 21955196 missense probably damaging 1.00
R9182:Reln UTSW 5 21901619 missense probably benign 0.44
R9196:Reln UTSW 5 22152473 missense probably damaging 1.00
R9211:Reln UTSW 5 22344202 nonsense probably null
R9241:Reln UTSW 5 21969069 missense probably damaging 0.99
R9244:Reln UTSW 5 21915153 missense probably damaging 0.99
R9281:Reln UTSW 5 21948547 missense probably damaging 1.00
R9295:Reln UTSW 5 22004211 missense possibly damaging 0.95
R9303:Reln UTSW 5 21988707 missense possibly damaging 0.95
R9303:Reln UTSW 5 22080691 missense probably benign 0.01
R9309:Reln UTSW 5 21971868 missense probably benign 0.37
R9338:Reln UTSW 5 21997939 missense probably damaging 0.98
R9381:Reln UTSW 5 22344204 missense possibly damaging 0.93
R9430:Reln UTSW 5 21915107 missense probably damaging 1.00
R9509:Reln UTSW 5 22344200 missense possibly damaging 0.93
R9515:Reln UTSW 5 21920510 missense possibly damaging 0.46
Z1176:Reln UTSW 5 21979024 missense probably damaging 1.00
Z1177:Reln UTSW 5 21969241 missense probably damaging 0.96
Z1177:Reln UTSW 5 22004082 missense probably damaging 0.96
Z1177:Reln UTSW 5 22154959 missense probably benign 0.05
Z1177:Reln UTSW 5 22227636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGATGTTGGTACTGAAC -3'
(R):5'- GCTCCAACGTAACTGCAATTTAATG -3'

Sequencing Primer
(F):5'- TGGTACTGAACGAACATAGGTCTTG -3'
(R):5'- CAACTGTATTCATGGTCACAGG -3'
Posted On 2022-02-07