Incidental Mutation 'R9172:Vps33a'
ID 696459
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene Name VPS33A CORVET/HOPS core subunit
Synonyms 3830421M04Rik, bf
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123666820-123711104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123674604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
AlphaFold Q9D2N9
Predicted Effect probably benign
Transcript: ENSMUST00000031388
AA Change: T388A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: T388A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123,711,006 (GRCm39) missense probably benign 0.00
IGL01459:Vps33a APN 5 123,673,371 (GRCm39) missense probably benign 0.08
IGL02473:Vps33a APN 5 123,707,634 (GRCm39) missense probably damaging 1.00
IGL02899:Vps33a APN 5 123,669,239 (GRCm39) missense probably damaging 1.00
R0498:Vps33a UTSW 5 123,709,024 (GRCm39) missense probably benign 0.40
R1134:Vps33a UTSW 5 123,708,975 (GRCm39) missense probably damaging 0.97
R1928:Vps33a UTSW 5 123,696,684 (GRCm39) missense probably benign 0.02
R2012:Vps33a UTSW 5 123,669,244 (GRCm39) splice site probably null
R2926:Vps33a UTSW 5 123,707,634 (GRCm39) missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123,673,274 (GRCm39) splice site probably null
R3872:Vps33a UTSW 5 123,669,255 (GRCm39) missense probably benign 0.16
R4437:Vps33a UTSW 5 123,669,947 (GRCm39) missense probably benign
R5153:Vps33a UTSW 5 123,696,691 (GRCm39) missense probably damaging 1.00
R5396:Vps33a UTSW 5 123,696,693 (GRCm39) missense probably damaging 0.98
R5686:Vps33a UTSW 5 123,685,064 (GRCm39) critical splice donor site probably null
R5714:Vps33a UTSW 5 123,707,563 (GRCm39) missense probably benign
R5814:Vps33a UTSW 5 123,703,119 (GRCm39) missense probably damaging 1.00
R6845:Vps33a UTSW 5 123,673,335 (GRCm39) missense probably benign 0.02
R7183:Vps33a UTSW 5 123,673,278 (GRCm39) missense probably null 0.83
R7359:Vps33a UTSW 5 123,696,696 (GRCm39) missense probably benign 0.00
R7593:Vps33a UTSW 5 123,674,619 (GRCm39) missense probably benign 0.00
R7855:Vps33a UTSW 5 123,709,042 (GRCm39) missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123,673,312 (GRCm39) missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123,696,738 (GRCm39) missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123,672,015 (GRCm39) missense probably benign 0.04
R8275:Vps33a UTSW 5 123,707,522 (GRCm39) missense probably damaging 0.99
R8434:Vps33a UTSW 5 123,671,944 (GRCm39) missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123,709,538 (GRCm39) critical splice donor site probably null
R8879:Vps33a UTSW 5 123,671,962 (GRCm39) missense probably damaging 1.00
R8880:Vps33a UTSW 5 123,707,506 (GRCm39) missense probably damaging 0.98
R9440:Vps33a UTSW 5 123,703,047 (GRCm39) missense probably damaging 1.00
R9502:Vps33a UTSW 5 123,696,705 (GRCm39) missense probably benign 0.00
R9725:Vps33a UTSW 5 123,669,135 (GRCm39) missense possibly damaging 0.95
X0026:Vps33a UTSW 5 123,685,160 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGAAACCAAAACAATGGCTTG -3'
(R):5'- AAGTCCTGACCTGGAAGGAG -3'

Sequencing Primer
(F):5'- TCCAGATGAGATGATGTCCCC -3'
(R):5'- CAGTGCTCTGGTGCTACCTG -3'
Posted On 2022-02-07