Incidental Mutation 'R9172:Erc1'
ID 696464
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene Name ELKS/RAB6-interacting/CAST family member 1
Synonyms 9630025C19Rik, Elks1, 5033405M01Rik, RAB6IP2B, B430107L16Rik, Rab6ip2, RAB6IP2A
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 119547757-119825128 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 119801842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 58 (N58K)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: N58K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079582
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: N58K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183880
AA Change: N58K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183911
AA Change: N58K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184838
AA Change: N58K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: N58K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185139
AA Change: N58K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185143
AA Change: N58K
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119,699,264 (GRCm39) missense probably damaging 0.96
IGL01345:Erc1 APN 6 119,738,224 (GRCm39) nonsense probably null
IGL01370:Erc1 APN 6 119,801,426 (GRCm39) missense probably damaging 1.00
IGL01443:Erc1 APN 6 119,801,432 (GRCm39) missense probably damaging 1.00
IGL01550:Erc1 APN 6 119,760,355 (GRCm39) missense probably damaging 0.96
IGL01798:Erc1 APN 6 119,597,298 (GRCm39) missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119,607,570 (GRCm39) missense probably damaging 1.00
IGL02239:Erc1 APN 6 119,750,852 (GRCm39) missense probably damaging 0.96
IGL02341:Erc1 APN 6 119,571,934 (GRCm39) missense possibly damaging 0.92
couch UTSW 6 119,720,390 (GRCm39) missense possibly damaging 0.81
divan UTSW 6 119,730,249 (GRCm39) missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119,756,452 (GRCm39) missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119,801,791 (GRCm39) missense probably damaging 1.00
R0277:Erc1 UTSW 6 119,597,289 (GRCm39) missense probably damaging 1.00
R0323:Erc1 UTSW 6 119,597,289 (GRCm39) missense probably damaging 1.00
R1053:Erc1 UTSW 6 119,773,887 (GRCm39) missense probably damaging 1.00
R1252:Erc1 UTSW 6 119,720,353 (GRCm39) missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119,720,381 (GRCm39) nonsense probably null
R1470:Erc1 UTSW 6 119,671,563 (GRCm39) missense probably damaging 1.00
R1470:Erc1 UTSW 6 119,671,563 (GRCm39) missense probably damaging 1.00
R1680:Erc1 UTSW 6 119,552,722 (GRCm39) missense probably damaging 1.00
R1833:Erc1 UTSW 6 119,720,390 (GRCm39) missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119,774,266 (GRCm39) missense probably damaging 1.00
R2037:Erc1 UTSW 6 119,699,216 (GRCm39) missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119,552,656 (GRCm39) missense probably damaging 1.00
R3751:Erc1 UTSW 6 119,801,921 (GRCm39) missense probably damaging 0.99
R4473:Erc1 UTSW 6 119,825,417 (GRCm39) splice site probably null
R4778:Erc1 UTSW 6 119,774,298 (GRCm39) splice site probably null
R4897:Erc1 UTSW 6 119,754,947 (GRCm39) critical splice donor site probably null
R5260:Erc1 UTSW 6 119,738,120 (GRCm39) missense probably damaging 1.00
R5382:Erc1 UTSW 6 119,738,233 (GRCm39) missense probably benign 0.02
R5405:Erc1 UTSW 6 119,801,905 (GRCm39) missense probably damaging 1.00
R5801:Erc1 UTSW 6 119,750,783 (GRCm39) missense probably damaging 0.99
R6341:Erc1 UTSW 6 119,754,959 (GRCm39) missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119,552,687 (GRCm39) missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119,801,912 (GRCm39) missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119,571,907 (GRCm39) nonsense probably null
R7532:Erc1 UTSW 6 119,756,592 (GRCm39) missense probably benign 0.02
R7575:Erc1 UTSW 6 119,801,721 (GRCm39) missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119,801,721 (GRCm39) missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119,801,564 (GRCm39) missense probably benign 0.33
R7740:Erc1 UTSW 6 119,738,149 (GRCm39) missense probably benign 0.02
R7789:Erc1 UTSW 6 119,750,670 (GRCm39) nonsense probably null
R7805:Erc1 UTSW 6 119,690,732 (GRCm39) missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119,801,447 (GRCm39) nonsense probably null
R8039:Erc1 UTSW 6 119,750,626 (GRCm39) nonsense probably null
R8229:Erc1 UTSW 6 119,730,249 (GRCm39) missense probably benign 0.27
R8363:Erc1 UTSW 6 119,730,260 (GRCm39) missense probably benign 0.00
R8794:Erc1 UTSW 6 119,607,616 (GRCm39) missense probably damaging 0.98
R9067:Erc1 UTSW 6 119,774,036 (GRCm39) missense possibly damaging 0.84
R9617:Erc1 UTSW 6 119,773,902 (GRCm39) missense probably benign 0.14
R9744:Erc1 UTSW 6 119,720,360 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGGTGATGTTCTCCAAATGC -3'
(R):5'- TCACCCTGCAACCATGTATG -3'

Sequencing Primer
(F):5'- TGCTATGGTATCACTAGCAACC -3'
(R):5'- CATGTATGGAAGTGCTCGATCAG -3'
Posted On 2022-02-07