Mutagenetix > Incidental Mutation

Incidental Mutation 'R9172:Grin2b'

696467

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9172 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135779257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 490 (I490T)

Ref Sequence

ENSEMBL: ENSMUSP00000062284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: I490T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I490T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: I490T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I490T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	C	7: 127,385,454	K159E	probably benign	Het
Accsl	A	T	2: 93,861,488	L332Q	probably damaging	Het
Adcy1	A	G	11: 7,160,317	N855D	probably damaging	Het
Adgrl3	T	A	5: 81,774,404	C1199S	probably benign	Het
Alyref	G	A	11: 120,596,016	R140C	probably benign	Het
Arhgap26	A	T	18: 39,245,329	I92F	probably damaging	Het
Atp9b	G	A	18: 80,917,778	R73*	probably null	Het
Btaf1	G	A	19: 37,000,230	A1483T	probably damaging	Het
Casc1	A	G	6: 145,177,449	F564L	probably benign	Het
Cmtr2	T	C	8: 110,222,129	L357P	probably damaging	Het
Commd7	A	T	2: 153,628,554	L51Q	possibly damaging	Het
Cpd	T	A	11: 76,784,426	I1290L	probably benign	Het
Cry2	C	A	2: 92,413,648	E393D	probably damaging	Het
Ctsm	A	T	13: 61,537,829	M74K		Het
Dync2h1	T	C	9: 7,031,771	Y3491C	probably damaging	Het
Erc1	A	C	6: 119,824,881	N58K	possibly damaging	Het
Fbxw21	T	C	9: 109,146,696	T211A	probably benign	Het
Fry	T	C	5: 150,413,328	V1388A	probably benign	Het
Fuk	A	G	8: 110,883,925	W949R	probably damaging	Het
Gca	T	G	2: 62,690,024	I176S	probably damaging	Het
Gimap7	A	T	6: 48,723,827	K116*	probably null	Het
Gm40460	ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,710		probably benign	Het
Gm5415	G	T	1: 32,546,084	H248Q	probably benign	Het
Gm906	A	G	13: 50,247,381	F303S	probably benign	Het
Gm9195	A	C	14: 72,473,714	L428R	probably damaging	Het
Kif24	T	C	4: 41,400,442	T499A	probably benign	Het
Mbtps1	G	A	8: 119,533,369	T413I	probably damaging	Het
Med4	A	T	14: 73,513,925	S105C	probably benign	Het
Mgat1	G	A	11: 49,261,083	R131Q	probably damaging	Het
Mroh4	T	C	15: 74,606,112	*984W	probably null	Het
Mybpc1	T	C	10: 88,543,753	E628G	possibly damaging	Het
Myh8	C	T	11: 67,292,434	P713L	possibly damaging	Het
Myo7a	T	C	7: 98,083,162	D706G	probably benign	Het
Nbas	T	A	12: 13,374,750	C997S	possibly damaging	Het
Nkx2-1	C	A	12: 56,534,967	G32C	probably damaging	Het
Npas3	A	G	12: 54,065,870	T466A	probably benign	Het
Olfr1085	T	A	2: 86,657,535	I308L	probably benign	Het
Olfr487	T	C	7: 108,211,962	E189G	probably benign	Het
Opa1	C	T	16: 29,620,414	R683C	probably benign	Het
Opa3	C	T	7: 19,255,541	R110C	probably damaging	Het
Ppfibp2	T	A	7: 107,738,318	L609*	probably null	Het
Pygo2	T	A	3: 89,433,310	D338E	possibly damaging	Het
Pzp	A	T	6: 128,525,209	M59K	probably benign	Het
Reln	A	G	5: 21,950,817		probably null	Het
Ripor1	A	G	8: 105,621,201	D1097G	unknown	Het
Rmdn3	T	C	2: 119,138,382	K443E	probably benign	Het
Rnf145	A	G	11: 44,557,435	D373G	possibly damaging	Het
Sec23b	A	T	2: 144,559,259	E13D	probably benign	Het
Slc39a6	A	G	18: 24,582,342	F707S	probably damaging	Het
Sox11	G	A	12: 27,341,537	A291V	possibly damaging	Het
Spg20	T	A	3: 55,124,846	V367D	possibly damaging	Het
Strap	A	T	6: 137,741,367	K156N	probably benign	Het
Stxbp5	T	A	10: 9,769,408	I951F	possibly damaging	Het
Taar7a	T	C	10: 23,992,779	I235V	probably benign	Het
Tek	T	A	4: 94,804,346	N230K	probably benign	Het
Tyw1	T	A	5: 130,296,679	C469*	probably null	Het
Vcan	T	C	13: 89,679,931	H3132R	probably damaging	Het
Vmn2r24	A	G	6: 123,806,473	D544G	probably damaging	Het
Vmn2r3	A	T	3: 64,278,982	M94K	possibly damaging	Het
Vps33a	T	C	5: 123,536,541	T388A	probably benign	Het
Vta1	A	G	10: 14,675,999	I152T	probably damaging	Het
Vtcn1	A	G	3: 100,892,549	D242G	probably benign	Het
Zfp12	T	A	5: 143,245,465	C548S	probably damaging	Het
Zfp263	A	G	16: 3,749,459	D546G	probably benign	Het
Zfp324	T	A	7: 12,970,762	C293S	probably damaging	Het
Zscan4c	A	T	7: 11,009,892	I473F	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCAAAATTCTCATGGCCC -3'
(R):5'- AAATTCTACTGTGGGGATGAGG -3'

Sequencing Primer
(F):5'- TTCAGCAATTTGGCCAGCAG -3'
(R):5'- ATTTTCCTTCTTGTACAAAGTCTTGC -3'

Posted On

2022-02-07