Incidental Mutation 'R9172:Casc1'
ID 696469
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145177449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 564 (F564L)
Ref Sequence ENSEMBL: ENSMUSP00000062279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
AA Change: F564L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: F564L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111728
AA Change: F551L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: F551L

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
AA Change: F564L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: F564L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,454 K159E probably benign Het
Accsl A T 2: 93,861,488 L332Q probably damaging Het
Adcy1 A G 11: 7,160,317 N855D probably damaging Het
Adgrl3 T A 5: 81,774,404 C1199S probably benign Het
Alyref G A 11: 120,596,016 R140C probably benign Het
Arhgap26 A T 18: 39,245,329 I92F probably damaging Het
Atp9b G A 18: 80,917,778 R73* probably null Het
Btaf1 G A 19: 37,000,230 A1483T probably damaging Het
Cmtr2 T C 8: 110,222,129 L357P probably damaging Het
Commd7 A T 2: 153,628,554 L51Q possibly damaging Het
Cpd T A 11: 76,784,426 I1290L probably benign Het
Cry2 C A 2: 92,413,648 E393D probably damaging Het
Ctsm A T 13: 61,537,829 M74K Het
Dync2h1 T C 9: 7,031,771 Y3491C probably damaging Het
Erc1 A C 6: 119,824,881 N58K possibly damaging Het
Fbxw21 T C 9: 109,146,696 T211A probably benign Het
Fry T C 5: 150,413,328 V1388A probably benign Het
Fuk A G 8: 110,883,925 W949R probably damaging Het
Gca T G 2: 62,690,024 I176S probably damaging Het
Gimap7 A T 6: 48,723,827 K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5415 G T 1: 32,546,084 H248Q probably benign Het
Gm906 A G 13: 50,247,381 F303S probably benign Het
Gm9195 A C 14: 72,473,714 L428R probably damaging Het
Grin2b A G 6: 135,779,257 I490T possibly damaging Het
Kif24 T C 4: 41,400,442 T499A probably benign Het
Mbtps1 G A 8: 119,533,369 T413I probably damaging Het
Med4 A T 14: 73,513,925 S105C probably benign Het
Mgat1 G A 11: 49,261,083 R131Q probably damaging Het
Mroh4 T C 15: 74,606,112 *984W probably null Het
Mybpc1 T C 10: 88,543,753 E628G possibly damaging Het
Myh8 C T 11: 67,292,434 P713L possibly damaging Het
Myo7a T C 7: 98,083,162 D706G probably benign Het
Nbas T A 12: 13,374,750 C997S possibly damaging Het
Nkx2-1 C A 12: 56,534,967 G32C probably damaging Het
Npas3 A G 12: 54,065,870 T466A probably benign Het
Olfr1085 T A 2: 86,657,535 I308L probably benign Het
Olfr487 T C 7: 108,211,962 E189G probably benign Het
Opa1 C T 16: 29,620,414 R683C probably benign Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Ppfibp2 T A 7: 107,738,318 L609* probably null Het
Pygo2 T A 3: 89,433,310 D338E possibly damaging Het
Pzp A T 6: 128,525,209 M59K probably benign Het
Reln A G 5: 21,950,817 probably null Het
Ripor1 A G 8: 105,621,201 D1097G unknown Het
Rmdn3 T C 2: 119,138,382 K443E probably benign Het
Rnf145 A G 11: 44,557,435 D373G possibly damaging Het
Sec23b A T 2: 144,559,259 E13D probably benign Het
Slc39a6 A G 18: 24,582,342 F707S probably damaging Het
Sox11 G A 12: 27,341,537 A291V possibly damaging Het
Spg20 T A 3: 55,124,846 V367D possibly damaging Het
Strap A T 6: 137,741,367 K156N probably benign Het
Stxbp5 T A 10: 9,769,408 I951F possibly damaging Het
Taar7a T C 10: 23,992,779 I235V probably benign Het
Tek T A 4: 94,804,346 N230K probably benign Het
Tyw1 T A 5: 130,296,679 C469* probably null Het
Vcan T C 13: 89,679,931 H3132R probably damaging Het
Vmn2r24 A G 6: 123,806,473 D544G probably damaging Het
Vmn2r3 A T 3: 64,278,982 M94K possibly damaging Het
Vps33a T C 5: 123,536,541 T388A probably benign Het
Vta1 A G 10: 14,675,999 I152T probably damaging Het
Vtcn1 A G 3: 100,892,549 D242G probably benign Het
Zfp12 T A 5: 143,245,465 C548S probably damaging Het
Zfp263 A G 16: 3,749,459 D546G probably benign Het
Zfp324 T A 7: 12,970,762 C293S probably damaging Het
Zscan4c A T 7: 11,009,892 I473F possibly damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAGCTGAGAGGAACCTGG -3'
(R):5'- CAGCTTCCAGAAGAGTCCCAAG -3'

Sequencing Primer
(F):5'- GGTGTTTTCCCTGACACAGTTGAAC -3'
(R):5'- GACAGACCAGAGGCATTATTTAGTG -3'
Posted On 2022-02-07