Incidental Mutation 'R9172:Myo7a'
ID 696473
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Name myosin VIIA
Synonyms nmf371, USH1B, polka, Hdb, Myo7
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97700267-97768731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97732369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 706 (D706G)
Ref Sequence ENSEMBL: ENSMUSP00000082046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000205746]
AlphaFold P97479
Predicted Effect probably benign
Transcript: ENSMUST00000084979
AA Change: D706G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: D706G

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107122
AA Change: D712G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: D712G

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
AA Change: D717G

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: D717G

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
AA Change: D717G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: D717G

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205746
AA Change: D706G

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 97,751,833 (GRCm39) missense probably damaging 1.00
IGL00785:Myo7a APN 7 97,703,555 (GRCm39) missense probably damaging 0.99
IGL00840:Myo7a APN 7 97,700,866 (GRCm39) missense probably benign 0.25
IGL01362:Myo7a APN 7 97,746,909 (GRCm39) missense probably damaging 1.00
IGL01484:Myo7a APN 7 97,734,629 (GRCm39) missense probably damaging 1.00
IGL01673:Myo7a APN 7 97,703,915 (GRCm39) missense probably benign 0.00
IGL01933:Myo7a APN 7 97,732,349 (GRCm39) missense probably damaging 1.00
IGL01943:Myo7a APN 7 97,714,854 (GRCm39) missense possibly damaging 0.96
IGL02188:Myo7a APN 7 97,740,234 (GRCm39) missense probably damaging 0.96
IGL02304:Myo7a APN 7 97,726,943 (GRCm39) missense possibly damaging 0.89
IGL02305:Myo7a APN 7 97,700,836 (GRCm39) makesense probably null
IGL02331:Myo7a APN 7 97,702,389 (GRCm39) missense possibly damaging 0.95
IGL02386:Myo7a APN 7 97,724,319 (GRCm39) missense probably damaging 0.99
IGL02389:Myo7a APN 7 97,756,198 (GRCm39) critical splice donor site probably null
IGL02832:Myo7a APN 7 97,740,227 (GRCm39) critical splice donor site probably null
IGL02839:Myo7a APN 7 97,740,329 (GRCm39) missense probably damaging 1.00
IGL03193:Myo7a APN 7 97,740,264 (GRCm39) missense probably damaging 1.00
IGL03237:Myo7a APN 7 97,751,800 (GRCm39) missense probably damaging 1.00
IGL03384:Myo7a APN 7 97,742,800 (GRCm39) missense probably damaging 1.00
coward UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
H8786:Myo7a UTSW 7 97,744,985 (GRCm39) missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 97,728,534 (GRCm39) missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 97,705,974 (GRCm39) missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 97,712,806 (GRCm39) missense probably benign 0.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0267:Myo7a UTSW 7 97,703,831 (GRCm39) missense probably benign 0.08
R0408:Myo7a UTSW 7 97,705,988 (GRCm39) missense probably damaging 1.00
R0411:Myo7a UTSW 7 97,721,144 (GRCm39) missense probably benign 0.00
R0540:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0607:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0629:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R0632:Myo7a UTSW 7 97,761,357 (GRCm39) intron probably benign
R0659:Myo7a UTSW 7 97,703,545 (GRCm39) splice site probably benign
R0735:Myo7a UTSW 7 97,730,387 (GRCm39) splice site probably benign
R0924:Myo7a UTSW 7 97,747,463 (GRCm39) missense probably damaging 0.99
R0930:Myo7a UTSW 7 97,747,463 (GRCm39) missense probably damaging 0.99
R1018:Myo7a UTSW 7 97,756,212 (GRCm39) missense probably damaging 1.00
R1196:Myo7a UTSW 7 97,746,880 (GRCm39) missense possibly damaging 0.87
R1331:Myo7a UTSW 7 97,756,215 (GRCm39) missense probably benign 0.00
R1487:Myo7a UTSW 7 97,703,017 (GRCm39) critical splice donor site probably null
R1676:Myo7a UTSW 7 97,748,679 (GRCm39) critical splice donor site probably null
R1695:Myo7a UTSW 7 97,741,703 (GRCm39) missense possibly damaging 0.94
R1770:Myo7a UTSW 7 97,761,813 (GRCm39) intron probably benign
R1781:Myo7a UTSW 7 97,722,331 (GRCm39) missense probably damaging 1.00
R1789:Myo7a UTSW 7 97,756,302 (GRCm39) missense probably damaging 0.99
R1827:Myo7a UTSW 7 97,725,938 (GRCm39) missense probably damaging 0.99
R1864:Myo7a UTSW 7 97,701,463 (GRCm39) missense probably damaging 1.00
R1955:Myo7a UTSW 7 97,704,128 (GRCm39) missense probably damaging 1.00
R2011:Myo7a UTSW 7 97,703,915 (GRCm39) missense possibly damaging 0.69
R2229:Myo7a UTSW 7 97,704,117 (GRCm39) missense probably benign 0.12
R2259:Myo7a UTSW 7 97,718,706 (GRCm39) missense probably damaging 1.00
R2443:Myo7a UTSW 7 97,744,976 (GRCm39) missense probably benign 0.07
R2898:Myo7a UTSW 7 97,746,413 (GRCm39) missense probably damaging 1.00
R2898:Myo7a UTSW 7 97,703,631 (GRCm39) nonsense probably null
R3158:Myo7a UTSW 7 97,701,499 (GRCm39) missense probably damaging 1.00
R3408:Myo7a UTSW 7 97,730,294 (GRCm39) missense probably benign 0.00
R4222:Myo7a UTSW 7 97,722,436 (GRCm39) missense possibly damaging 0.93
R4255:Myo7a UTSW 7 97,721,171 (GRCm39) missense probably damaging 0.96
R4374:Myo7a UTSW 7 97,751,881 (GRCm39) missense probably damaging 1.00
R4429:Myo7a UTSW 7 97,702,395 (GRCm39) missense probably damaging 0.99
R4445:Myo7a UTSW 7 97,715,611 (GRCm39) missense probably damaging 1.00
R4579:Myo7a UTSW 7 97,722,400 (GRCm39) missense probably damaging 1.00
R4659:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R5073:Myo7a UTSW 7 97,722,425 (GRCm39) nonsense probably null
R5138:Myo7a UTSW 7 97,732,806 (GRCm39) missense probably damaging 1.00
R5566:Myo7a UTSW 7 97,714,023 (GRCm39) missense possibly damaging 0.93
R5580:Myo7a UTSW 7 97,722,367 (GRCm39) missense probably damaging 1.00
R6079:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6138:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6451:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6452:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6453:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6454:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6455:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6465:Myo7a UTSW 7 97,711,887 (GRCm39) missense possibly damaging 0.95
R6653:Myo7a UTSW 7 97,703,710 (GRCm39) missense probably damaging 0.96
R6709:Myo7a UTSW 7 97,703,906 (GRCm39) missense probably damaging 1.00
R6917:Myo7a UTSW 7 97,744,970 (GRCm39) missense possibly damaging 0.58
R7313:Myo7a UTSW 7 97,713,402 (GRCm39) missense probably damaging 0.99
R7334:Myo7a UTSW 7 97,728,573 (GRCm39) missense probably benign
R7356:Myo7a UTSW 7 97,751,890 (GRCm39) missense probably benign 0.01
R7393:Myo7a UTSW 7 97,712,906 (GRCm39) missense possibly damaging 0.91
R7422:Myo7a UTSW 7 97,700,833 (GRCm39) splice site probably null
R7472:Myo7a UTSW 7 97,714,000 (GRCm39) missense probably damaging 1.00
R7483:Myo7a UTSW 7 97,712,881 (GRCm39) missense probably benign 0.07
R7526:Myo7a UTSW 7 97,734,655 (GRCm39) missense possibly damaging 0.49
R7948:Myo7a UTSW 7 97,724,236 (GRCm39) missense probably damaging 1.00
R8069:Myo7a UTSW 7 97,732,833 (GRCm39) nonsense probably null
R8115:Myo7a UTSW 7 97,715,653 (GRCm39) missense probably damaging 0.98
R8150:Myo7a UTSW 7 97,712,846 (GRCm39) missense probably benign 0.19
R8265:Myo7a UTSW 7 97,734,604 (GRCm39) missense probably benign 0.00
R8289:Myo7a UTSW 7 97,726,376 (GRCm39) missense probably benign
R8298:Myo7a UTSW 7 97,747,541 (GRCm39) missense probably damaging 1.00
R8518:Myo7a UTSW 7 97,740,270 (GRCm39) missense possibly damaging 0.58
R8539:Myo7a UTSW 7 97,721,668 (GRCm39) missense probably damaging 0.99
R8557:Myo7a UTSW 7 97,703,081 (GRCm39) missense probably benign 0.08
R8685:Myo7a UTSW 7 97,746,334 (GRCm39) missense probably benign 0.03
R8902:Myo7a UTSW 7 97,741,820 (GRCm39) missense probably damaging 1.00
R9034:Myo7a UTSW 7 97,728,465 (GRCm39) missense probably benign 0.40
R9090:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9271:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9334:Myo7a UTSW 7 97,716,369 (GRCm39) missense probably damaging 1.00
R9356:Myo7a UTSW 7 97,725,873 (GRCm39) missense probably benign 0.11
R9444:Myo7a UTSW 7 97,742,698 (GRCm39) missense possibly damaging 0.84
R9459:Myo7a UTSW 7 97,722,380 (GRCm39) missense possibly damaging 0.65
R9513:Myo7a UTSW 7 97,746,818 (GRCm39) critical splice donor site probably null
R9517:Myo7a UTSW 7 97,721,166 (GRCm39) missense probably damaging 1.00
R9629:Myo7a UTSW 7 97,712,937 (GRCm39) missense probably benign 0.03
R9662:Myo7a UTSW 7 97,747,499 (GRCm39) missense possibly damaging 0.55
R9709:Myo7a UTSW 7 97,743,536 (GRCm39) missense possibly damaging 0.79
RF005:Myo7a UTSW 7 97,742,824 (GRCm39) missense probably benign 0.42
U15987:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
X0028:Myo7a UTSW 7 97,714,932 (GRCm39) missense probably damaging 1.00
X0058:Myo7a UTSW 7 97,711,855 (GRCm39) missense probably benign 0.02
Z1176:Myo7a UTSW 7 97,744,934 (GRCm39) missense probably damaging 0.98
Z1177:Myo7a UTSW 7 97,734,730 (GRCm39) critical splice acceptor site probably null
Z1177:Myo7a UTSW 7 97,701,433 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTGGCACCATGAGTTATC -3'
(R):5'- TTGGCTTGAGGAGAAAACAGATTTC -3'

Sequencing Primer
(F):5'- GGCACCATGAGTTATCTCTAATGCAC -3'
(R):5'- GGGGCCTTTCCATTAGT -3'
Posted On 2022-02-07