Incidental Mutation 'R9172:Taar7a'
ID 696486
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Name trace amine-associated receptor 7A
Synonyms Taar7a, LOC215856
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 23992405-23993481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23992779 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 235 (I235V)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
AlphaFold Q5QD12
Predicted Effect probably benign
Transcript: ENSMUST00000078532
AA Change: I235V

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: I235V

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,454 K159E probably benign Het
Accsl A T 2: 93,861,488 L332Q probably damaging Het
Adcy1 A G 11: 7,160,317 N855D probably damaging Het
Adgrl3 T A 5: 81,774,404 C1199S probably benign Het
Alyref G A 11: 120,596,016 R140C probably benign Het
Arhgap26 A T 18: 39,245,329 I92F probably damaging Het
Atp9b G A 18: 80,917,778 R73* probably null Het
Btaf1 G A 19: 37,000,230 A1483T probably damaging Het
Casc1 A G 6: 145,177,449 F564L probably benign Het
Cmtr2 T C 8: 110,222,129 L357P probably damaging Het
Commd7 A T 2: 153,628,554 L51Q possibly damaging Het
Cpd T A 11: 76,784,426 I1290L probably benign Het
Cry2 C A 2: 92,413,648 E393D probably damaging Het
Ctsm A T 13: 61,537,829 M74K Het
Dync2h1 T C 9: 7,031,771 Y3491C probably damaging Het
Erc1 A C 6: 119,824,881 N58K possibly damaging Het
Fbxw21 T C 9: 109,146,696 T211A probably benign Het
Fry T C 5: 150,413,328 V1388A probably benign Het
Fuk A G 8: 110,883,925 W949R probably damaging Het
Gca T G 2: 62,690,024 I176S probably damaging Het
Gimap7 A T 6: 48,723,827 K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5415 G T 1: 32,546,084 H248Q probably benign Het
Gm906 A G 13: 50,247,381 F303S probably benign Het
Gm9195 A C 14: 72,473,714 L428R probably damaging Het
Grin2b A G 6: 135,779,257 I490T possibly damaging Het
Kif24 T C 4: 41,400,442 T499A probably benign Het
Mbtps1 G A 8: 119,533,369 T413I probably damaging Het
Med4 A T 14: 73,513,925 S105C probably benign Het
Mgat1 G A 11: 49,261,083 R131Q probably damaging Het
Mroh4 T C 15: 74,606,112 *984W probably null Het
Mybpc1 T C 10: 88,543,753 E628G possibly damaging Het
Myh8 C T 11: 67,292,434 P713L possibly damaging Het
Myo7a T C 7: 98,083,162 D706G probably benign Het
Nbas T A 12: 13,374,750 C997S possibly damaging Het
Nkx2-1 C A 12: 56,534,967 G32C probably damaging Het
Npas3 A G 12: 54,065,870 T466A probably benign Het
Olfr1085 T A 2: 86,657,535 I308L probably benign Het
Olfr487 T C 7: 108,211,962 E189G probably benign Het
Opa1 C T 16: 29,620,414 R683C probably benign Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Ppfibp2 T A 7: 107,738,318 L609* probably null Het
Pygo2 T A 3: 89,433,310 D338E possibly damaging Het
Pzp A T 6: 128,525,209 M59K probably benign Het
Reln A G 5: 21,950,817 probably null Het
Ripor1 A G 8: 105,621,201 D1097G unknown Het
Rmdn3 T C 2: 119,138,382 K443E probably benign Het
Rnf145 A G 11: 44,557,435 D373G possibly damaging Het
Sec23b A T 2: 144,559,259 E13D probably benign Het
Slc39a6 A G 18: 24,582,342 F707S probably damaging Het
Sox11 G A 12: 27,341,537 A291V possibly damaging Het
Spg20 T A 3: 55,124,846 V367D possibly damaging Het
Strap A T 6: 137,741,367 K156N probably benign Het
Stxbp5 T A 10: 9,769,408 I951F possibly damaging Het
Tek T A 4: 94,804,346 N230K probably benign Het
Tyw1 T A 5: 130,296,679 C469* probably null Het
Vcan T C 13: 89,679,931 H3132R probably damaging Het
Vmn2r24 A G 6: 123,806,473 D544G probably damaging Het
Vmn2r3 A T 3: 64,278,982 M94K possibly damaging Het
Vps33a T C 5: 123,536,541 T388A probably benign Het
Vta1 A G 10: 14,675,999 I152T probably damaging Het
Vtcn1 A G 3: 100,892,549 D242G probably benign Het
Zfp12 T A 5: 143,245,465 C548S probably damaging Het
Zfp263 A G 16: 3,749,459 D546G probably benign Het
Zfp324 T A 7: 12,970,762 C293S probably damaging Het
Zscan4c A T 7: 11,009,892 I473F possibly damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23992396 unclassified probably benign
IGL02408:Taar7a APN 10 23992602 missense probably benign
PIT4434001:Taar7a UTSW 10 23993421 missense probably benign
R0422:Taar7a UTSW 10 23993274 missense probably benign 0.02
R1029:Taar7a UTSW 10 23992541 missense possibly damaging 0.65
R1742:Taar7a UTSW 10 23993219 missense probably damaging 0.98
R2104:Taar7a UTSW 10 23993061 missense probably damaging 0.99
R2421:Taar7a UTSW 10 23992517 missense probably damaging 1.00
R3907:Taar7a UTSW 10 23992559 missense probably benign 0.25
R4021:Taar7a UTSW 10 23993386 missense probably benign 0.00
R5180:Taar7a UTSW 10 23993148 missense probably damaging 1.00
R5486:Taar7a UTSW 10 23992458 missense probably benign 0.00
R5507:Taar7a UTSW 10 23992631 missense probably damaging 0.98
R5587:Taar7a UTSW 10 23992828 missense probably benign 0.00
R5766:Taar7a UTSW 10 23993362 missense probably benign 0.01
R5861:Taar7a UTSW 10 23992439 missense probably benign
R7201:Taar7a UTSW 10 23992460 missense probably benign 0.04
R7506:Taar7a UTSW 10 23992994 missense possibly damaging 0.50
R8810:Taar7a UTSW 10 23993381 missense probably benign 0.20
R9015:Taar7a UTSW 10 23992835 missense probably damaging 0.97
R9686:Taar7a UTSW 10 23993411 missense probably benign 0.01
R9717:Taar7a UTSW 10 23992901 missense probably benign 0.01
R9720:Taar7a UTSW 10 23992835 missense probably benign 0.10
X0064:Taar7a UTSW 10 23992617 missense probably damaging 1.00
Z1177:Taar7a UTSW 10 23992892 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCCTAGGAAGGCATCAATG -3'
(R):5'- AAGTGCATCACCTTCTCCTGG -3'

Sequencing Primer
(F):5'- GGCATCAATGATGGAGTCAATG -3'
(R):5'- GGCTCCTGTCCATCATCTACAG -3'
Posted On 2022-02-07