Incidental Mutation 'R9172:Cpd'
ID 696492
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Name carboxypeptidase D
Synonyms D830034L15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76778424-76847018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76784426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1290 (I1290L)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
AlphaFold O89001
Predicted Effect probably benign
Transcript: ENSMUST00000021201
AA Change: I1290L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: I1290L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,454 K159E probably benign Het
Accsl A T 2: 93,861,488 L332Q probably damaging Het
Adcy1 A G 11: 7,160,317 N855D probably damaging Het
Adgrl3 T A 5: 81,774,404 C1199S probably benign Het
Alyref G A 11: 120,596,016 R140C probably benign Het
Arhgap26 A T 18: 39,245,329 I92F probably damaging Het
Atp9b G A 18: 80,917,778 R73* probably null Het
Btaf1 G A 19: 37,000,230 A1483T probably damaging Het
Casc1 A G 6: 145,177,449 F564L probably benign Het
Cmtr2 T C 8: 110,222,129 L357P probably damaging Het
Commd7 A T 2: 153,628,554 L51Q possibly damaging Het
Cry2 C A 2: 92,413,648 E393D probably damaging Het
Ctsm A T 13: 61,537,829 M74K Het
Dync2h1 T C 9: 7,031,771 Y3491C probably damaging Het
Erc1 A C 6: 119,824,881 N58K possibly damaging Het
Fbxw21 T C 9: 109,146,696 T211A probably benign Het
Fry T C 5: 150,413,328 V1388A probably benign Het
Fuk A G 8: 110,883,925 W949R probably damaging Het
Gca T G 2: 62,690,024 I176S probably damaging Het
Gimap7 A T 6: 48,723,827 K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5415 G T 1: 32,546,084 H248Q probably benign Het
Gm906 A G 13: 50,247,381 F303S probably benign Het
Gm9195 A C 14: 72,473,714 L428R probably damaging Het
Grin2b A G 6: 135,779,257 I490T possibly damaging Het
Kif24 T C 4: 41,400,442 T499A probably benign Het
Mbtps1 G A 8: 119,533,369 T413I probably damaging Het
Med4 A T 14: 73,513,925 S105C probably benign Het
Mgat1 G A 11: 49,261,083 R131Q probably damaging Het
Mroh4 T C 15: 74,606,112 *984W probably null Het
Mybpc1 T C 10: 88,543,753 E628G possibly damaging Het
Myh8 C T 11: 67,292,434 P713L possibly damaging Het
Myo7a T C 7: 98,083,162 D706G probably benign Het
Nbas T A 12: 13,374,750 C997S possibly damaging Het
Nkx2-1 C A 12: 56,534,967 G32C probably damaging Het
Npas3 A G 12: 54,065,870 T466A probably benign Het
Olfr1085 T A 2: 86,657,535 I308L probably benign Het
Olfr487 T C 7: 108,211,962 E189G probably benign Het
Opa1 C T 16: 29,620,414 R683C probably benign Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Ppfibp2 T A 7: 107,738,318 L609* probably null Het
Pygo2 T A 3: 89,433,310 D338E possibly damaging Het
Pzp A T 6: 128,525,209 M59K probably benign Het
Reln A G 5: 21,950,817 probably null Het
Ripor1 A G 8: 105,621,201 D1097G unknown Het
Rmdn3 T C 2: 119,138,382 K443E probably benign Het
Rnf145 A G 11: 44,557,435 D373G possibly damaging Het
Sec23b A T 2: 144,559,259 E13D probably benign Het
Slc39a6 A G 18: 24,582,342 F707S probably damaging Het
Sox11 G A 12: 27,341,537 A291V possibly damaging Het
Spg20 T A 3: 55,124,846 V367D possibly damaging Het
Strap A T 6: 137,741,367 K156N probably benign Het
Stxbp5 T A 10: 9,769,408 I951F possibly damaging Het
Taar7a T C 10: 23,992,779 I235V probably benign Het
Tek T A 4: 94,804,346 N230K probably benign Het
Tyw1 T A 5: 130,296,679 C469* probably null Het
Vcan T C 13: 89,679,931 H3132R probably damaging Het
Vmn2r24 A G 6: 123,806,473 D544G probably damaging Het
Vmn2r3 A T 3: 64,278,982 M94K possibly damaging Het
Vps33a T C 5: 123,536,541 T388A probably benign Het
Vta1 A G 10: 14,675,999 I152T probably damaging Het
Vtcn1 A G 3: 100,892,549 D242G probably benign Het
Zfp12 T A 5: 143,245,465 C548S probably damaging Het
Zfp263 A G 16: 3,749,459 D546G probably benign Het
Zfp324 T A 7: 12,970,762 C293S probably damaging Het
Zscan4c A T 7: 11,009,892 I473F possibly damaging Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
R8935:Cpd UTSW 11 76840469 missense probably damaging 1.00
R9151:Cpd UTSW 11 76784449 missense possibly damaging 0.54
R9173:Cpd UTSW 11 76808823 missense probably damaging 0.97
R9310:Cpd UTSW 11 76814781 nonsense probably null
R9666:Cpd UTSW 11 76802307 missense probably benign 0.02
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATAGGACAACAGTAGCTTGGG -3'
(R):5'- GGCTTCAGTATCCTATAAGTGGC -3'

Sequencing Primer
(F):5'- GACAACAGTAGCTTGGGAAAATC -3'
(R):5'- GATTCCTGGATTCCCTTGAACTAGAG -3'
Posted On 2022-02-07