Incidental Mutation 'R9172:Nbas'
ID 696494
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Name neuroblastoma amplified sequence
Synonyms 4933425L03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 13319134-13633812 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13424751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 997 (C997S)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
AlphaFold E9Q411
Predicted Effect possibly damaging
Transcript: ENSMUST00000042953
AA Change: C997S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: C997S

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13,503,076 (GRCm39) missense probably benign 0.19
IGL00712:Nbas APN 12 13,412,626 (GRCm39) splice site probably benign
IGL00808:Nbas APN 12 13,616,121 (GRCm39) splice site probably benign
IGL00915:Nbas APN 12 13,424,753 (GRCm39) nonsense probably null
IGL00923:Nbas APN 12 13,386,285 (GRCm39) missense possibly damaging 0.46
IGL01152:Nbas APN 12 13,410,959 (GRCm39) missense probably damaging 1.00
IGL01633:Nbas APN 12 13,533,898 (GRCm39) missense probably damaging 1.00
IGL01672:Nbas APN 12 13,429,650 (GRCm39) missense possibly damaging 0.63
IGL01799:Nbas APN 12 13,374,401 (GRCm39) splice site probably benign
IGL01812:Nbas APN 12 13,503,504 (GRCm39) missense probably damaging 1.00
IGL01934:Nbas APN 12 13,339,880 (GRCm39) splice site probably benign
IGL02093:Nbas APN 12 13,610,963 (GRCm39) missense probably benign 0.00
IGL02115:Nbas APN 12 13,367,693 (GRCm39) splice site probably benign
IGL02175:Nbas APN 12 13,616,260 (GRCm39) critical splice donor site probably null
IGL02268:Nbas APN 12 13,455,398 (GRCm39) missense possibly damaging 0.94
IGL02483:Nbas APN 12 13,374,295 (GRCm39) missense probably damaging 1.00
IGL02539:Nbas APN 12 13,322,704 (GRCm39) splice site probably benign
IGL02557:Nbas APN 12 13,411,029 (GRCm39) missense probably damaging 1.00
IGL02815:Nbas APN 12 13,360,267 (GRCm39) missense probably damaging 1.00
IGL02951:Nbas APN 12 13,412,542 (GRCm39) missense probably benign
IGL03131:Nbas APN 12 13,329,417 (GRCm39) missense probably benign 0.03
IGL03214:Nbas APN 12 13,381,111 (GRCm39) splice site probably benign
IGL03308:Nbas APN 12 13,374,349 (GRCm39) missense possibly damaging 0.93
IGL03368:Nbas APN 12 13,378,452 (GRCm39) missense probably benign 0.08
IGL03372:Nbas APN 12 13,584,473 (GRCm39) missense probably damaging 1.00
IGL03391:Nbas APN 12 13,533,750 (GRCm39) missense probably benign 0.28
medvedev UTSW 12 13,584,578 (GRCm39) critical splice donor site probably null
oligarchs UTSW 12 13,570,751 (GRCm39) missense possibly damaging 0.75
putin UTSW 12 13,371,756 (GRCm39) missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13,338,729 (GRCm39) missense probably damaging 1.00
R0057:Nbas UTSW 12 13,440,958 (GRCm39) missense probably benign 0.00
R0076:Nbas UTSW 12 13,374,337 (GRCm39) missense probably damaging 1.00
R0153:Nbas UTSW 12 13,323,877 (GRCm39) splice site probably benign
R0371:Nbas UTSW 12 13,381,096 (GRCm39) missense probably damaging 0.97
R0449:Nbas UTSW 12 13,569,109 (GRCm39) missense probably benign 0.18
R0791:Nbas UTSW 12 13,532,634 (GRCm39) missense probably benign 0.28
R0931:Nbas UTSW 12 13,381,115 (GRCm39) splice site probably benign
R1236:Nbas UTSW 12 13,319,242 (GRCm39) missense probably damaging 1.00
R1371:Nbas UTSW 12 13,532,379 (GRCm39) splice site probably benign
R1567:Nbas UTSW 12 13,335,279 (GRCm39) missense possibly damaging 0.70
R1587:Nbas UTSW 12 13,608,686 (GRCm39) missense probably benign
R1719:Nbas UTSW 12 13,610,978 (GRCm39) critical splice donor site probably null
R1747:Nbas UTSW 12 13,385,899 (GRCm39) missense probably benign 0.00
R1777:Nbas UTSW 12 13,563,563 (GRCm39) missense probably benign 0.16
R1848:Nbas UTSW 12 13,463,598 (GRCm39) missense probably damaging 0.97
R1856:Nbas UTSW 12 13,524,230 (GRCm39) missense possibly damaging 0.56
R1891:Nbas UTSW 12 13,440,973 (GRCm39) missense possibly damaging 0.92
R1911:Nbas UTSW 12 13,616,145 (GRCm39) missense probably benign
R1912:Nbas UTSW 12 13,616,145 (GRCm39) missense probably benign
R2006:Nbas UTSW 12 13,464,742 (GRCm39) splice site probably null
R2054:Nbas UTSW 12 13,524,207 (GRCm39) missense probably benign 0.36
R2065:Nbas UTSW 12 13,616,158 (GRCm39) missense probably damaging 1.00
R2089:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2091:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2091:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2156:Nbas UTSW 12 13,491,510 (GRCm39) missense probably damaging 1.00
R2164:Nbas UTSW 12 13,380,647 (GRCm39) missense possibly damaging 0.74
R2339:Nbas UTSW 12 13,412,593 (GRCm39) missense probably benign 0.12
R2398:Nbas UTSW 12 13,482,946 (GRCm39) missense probably damaging 0.99
R3806:Nbas UTSW 12 13,532,505 (GRCm39) missense probably damaging 1.00
R3855:Nbas UTSW 12 13,329,415 (GRCm39) missense possibly damaging 0.50
R4019:Nbas UTSW 12 13,532,520 (GRCm39) missense probably damaging 1.00
R4083:Nbas UTSW 12 13,524,192 (GRCm39) missense probably damaging 0.96
R4201:Nbas UTSW 12 13,424,827 (GRCm39) missense probably benign 0.00
R4231:Nbas UTSW 12 13,443,344 (GRCm39) missense probably damaging 0.98
R4552:Nbas UTSW 12 13,385,938 (GRCm39) critical splice donor site probably null
R4560:Nbas UTSW 12 13,633,528 (GRCm39) missense probably benign 0.00
R4728:Nbas UTSW 12 13,338,740 (GRCm39) missense probably damaging 0.98
R4752:Nbas UTSW 12 13,532,538 (GRCm39) missense possibly damaging 0.92
R4832:Nbas UTSW 12 13,533,740 (GRCm39) missense probably benign 0.00
R4874:Nbas UTSW 12 13,371,756 (GRCm39) missense probably damaging 1.00
R4988:Nbas UTSW 12 13,458,266 (GRCm39) missense probably benign 0.45
R5020:Nbas UTSW 12 13,424,713 (GRCm39) missense probably damaging 0.99
R5079:Nbas UTSW 12 13,424,712 (GRCm39) missense probably damaging 1.00
R5129:Nbas UTSW 12 13,440,961 (GRCm39) missense probably damaging 1.00
R5239:Nbas UTSW 12 13,491,519 (GRCm39) missense probably benign 0.31
R5299:Nbas UTSW 12 13,491,926 (GRCm39) nonsense probably null
R5351:Nbas UTSW 12 13,610,850 (GRCm39) missense probably damaging 1.00
R5389:Nbas UTSW 12 13,584,578 (GRCm39) critical splice donor site probably null
R5436:Nbas UTSW 12 13,424,812 (GRCm39) missense probably damaging 1.00
R5654:Nbas UTSW 12 13,633,476 (GRCm39) missense probably damaging 1.00
R5690:Nbas UTSW 12 13,386,285 (GRCm39) missense probably damaging 1.00
R5842:Nbas UTSW 12 13,319,267 (GRCm39) critical splice donor site probably null
R5959:Nbas UTSW 12 13,338,802 (GRCm39) missense probably damaging 0.99
R5982:Nbas UTSW 12 13,443,431 (GRCm39) missense probably benign 0.00
R6238:Nbas UTSW 12 13,532,596 (GRCm39) missense probably benign
R6270:Nbas UTSW 12 13,374,294 (GRCm39) missense probably damaging 1.00
R6363:Nbas UTSW 12 13,532,577 (GRCm39) missense probably benign
R6424:Nbas UTSW 12 13,465,734 (GRCm39) critical splice donor site probably null
R6458:Nbas UTSW 12 13,338,750 (GRCm39) missense probably damaging 1.00
R6526:Nbas UTSW 12 13,455,426 (GRCm39) missense probably damaging 1.00
R6654:Nbas UTSW 12 13,533,875 (GRCm39) nonsense probably null
R7085:Nbas UTSW 12 13,335,259 (GRCm39) missense probably damaging 1.00
R7179:Nbas UTSW 12 13,455,398 (GRCm39) missense possibly damaging 0.94
R7197:Nbas UTSW 12 13,570,751 (GRCm39) missense possibly damaging 0.75
R7378:Nbas UTSW 12 13,324,220 (GRCm39) missense probably damaging 1.00
R7393:Nbas UTSW 12 13,443,493 (GRCm39) missense probably damaging 1.00
R7425:Nbas UTSW 12 13,519,881 (GRCm39) missense probably damaging 1.00
R7446:Nbas UTSW 12 13,443,499 (GRCm39) missense probably benign 0.02
R7481:Nbas UTSW 12 13,406,960 (GRCm39) missense probably damaging 0.97
R7535:Nbas UTSW 12 13,329,390 (GRCm39) missense probably damaging 0.97
R7626:Nbas UTSW 12 13,608,661 (GRCm39) missense probably benign 0.00
R7678:Nbas UTSW 12 13,465,662 (GRCm39) missense probably damaging 0.97
R7912:Nbas UTSW 12 13,455,458 (GRCm39) missense possibly damaging 0.91
R7964:Nbas UTSW 12 13,406,896 (GRCm39) missense probably damaging 0.99
R8193:Nbas UTSW 12 13,483,010 (GRCm39) missense probably damaging 1.00
R8325:Nbas UTSW 12 13,338,796 (GRCm39) missense probably damaging 1.00
R8405:Nbas UTSW 12 13,329,394 (GRCm39) missense probably damaging 1.00
R8437:Nbas UTSW 12 13,616,251 (GRCm39) missense possibly damaging 0.46
R8559:Nbas UTSW 12 13,402,809 (GRCm39) missense probably benign 0.00
R8684:Nbas UTSW 12 13,386,368 (GRCm39) missense probably damaging 1.00
R8826:Nbas UTSW 12 13,402,875 (GRCm39) splice site probably benign
R8921:Nbas UTSW 12 13,463,590 (GRCm39) missense probably benign
R8956:Nbas UTSW 12 13,482,923 (GRCm39) missense possibly damaging 0.51
R9083:Nbas UTSW 12 13,385,856 (GRCm39) missense possibly damaging 0.56
R9430:Nbas UTSW 12 13,371,654 (GRCm39) missense probably benign 0.35
R9627:Nbas UTSW 12 13,350,203 (GRCm39) missense possibly damaging 0.76
R9649:Nbas UTSW 12 13,633,417 (GRCm39) missense probably damaging 1.00
RF013:Nbas UTSW 12 13,329,409 (GRCm39) missense possibly damaging 0.54
T0722:Nbas UTSW 12 13,402,809 (GRCm39) missense probably benign 0.00
Z1176:Nbas UTSW 12 13,533,877 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCAAAAGTCTGCAAGCTACAG -3'
(R):5'- CGTGAATATAGAGCACTCACCC -3'

Sequencing Primer
(F):5'- GTCTGCAAGCTACAGAAAAATCAAG -3'
(R):5'- TAGTCTCAAAGTTCTCTGCTGATG -3'
Posted On 2022-02-07