Incidental Mutation 'R9172:Mroh4'
ID 696503
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Name maestro heat-like repeat family member 4
Synonyms 1700016M24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9172 (G1)
Quality Score 176.009
Status Validated
Chromosome 15
Chromosomal Location 74477878-74508202 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 74477961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 984 (*984W)
Ref Sequence ENSEMBL: ENSMUSP00000023271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
AlphaFold G3X8W1
Predicted Effect probably null
Transcript: ENSMUST00000023271
AA Change: *984W
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603
AA Change: *984W

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137963
AA Change: *915W
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603
AA Change: *915W

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Atp9b G A 18: 80,960,993 (GRCm39) R73* probably null Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74,483,207 (GRCm39) splice site probably benign
IGL02370:Mroh4 APN 15 74,497,390 (GRCm39) missense probably benign 0.00
IGL02598:Mroh4 APN 15 74,483,092 (GRCm39) critical splice donor site probably null
IGL02644:Mroh4 APN 15 74,482,224 (GRCm39) missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74,481,624 (GRCm39) missense probably benign 0.04
IGL02723:Mroh4 APN 15 74,480,086 (GRCm39) splice site probably benign
IGL02724:Mroh4 APN 15 74,478,000 (GRCm39) missense probably benign 0.00
IGL03000:Mroh4 APN 15 74,487,963 (GRCm39) missense probably benign
IGL03103:Mroh4 APN 15 74,488,008 (GRCm39) missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74,483,388 (GRCm39) missense probably damaging 1.00
R0013:Mroh4 UTSW 15 74,480,086 (GRCm39) splice site probably benign
R0042:Mroh4 UTSW 15 74,482,154 (GRCm39) missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74,482,154 (GRCm39) missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74,477,998 (GRCm39) missense probably benign
R0346:Mroh4 UTSW 15 74,486,141 (GRCm39) splice site probably benign
R0545:Mroh4 UTSW 15 74,497,276 (GRCm39) missense probably benign 0.00
R0688:Mroh4 UTSW 15 74,478,527 (GRCm39) missense probably damaging 0.98
R1838:Mroh4 UTSW 15 74,487,962 (GRCm39) missense probably benign 0.03
R2037:Mroh4 UTSW 15 74,481,610 (GRCm39) missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74,487,956 (GRCm39) missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74,482,083 (GRCm39) missense probably benign 0.08
R4798:Mroh4 UTSW 15 74,498,028 (GRCm39) missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74,483,857 (GRCm39) missense probably benign 0.00
R5065:Mroh4 UTSW 15 74,500,119 (GRCm39) splice site probably null
R5476:Mroh4 UTSW 15 74,483,510 (GRCm39) missense probably benign 0.15
R5509:Mroh4 UTSW 15 74,478,003 (GRCm39) missense probably benign 0.00
R5527:Mroh4 UTSW 15 74,486,865 (GRCm39) missense probably damaging 1.00
R5662:Mroh4 UTSW 15 74,497,277 (GRCm39) missense possibly damaging 0.63
R5818:Mroh4 UTSW 15 74,483,831 (GRCm39) missense probably damaging 0.98
R5861:Mroh4 UTSW 15 74,478,456 (GRCm39) intron probably benign
R5886:Mroh4 UTSW 15 74,478,296 (GRCm39) missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74,493,003 (GRCm39) missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74,497,321 (GRCm39) nonsense probably null
R6658:Mroh4 UTSW 15 74,492,978 (GRCm39) missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74,483,852 (GRCm39) missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74,481,568 (GRCm39) missense probably benign 0.10
R6888:Mroh4 UTSW 15 74,485,098 (GRCm39) missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74,497,993 (GRCm39) missense probably benign 0.25
R7260:Mroh4 UTSW 15 74,479,978 (GRCm39) missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74,482,220 (GRCm39) nonsense probably null
R7735:Mroh4 UTSW 15 74,497,357 (GRCm39) missense probably damaging 0.98
R7763:Mroh4 UTSW 15 74,496,554 (GRCm39) missense probably damaging 0.99
R7945:Mroh4 UTSW 15 74,496,554 (GRCm39) missense probably damaging 0.99
R8090:Mroh4 UTSW 15 74,496,550 (GRCm39) missense probably benign 0.41
R8242:Mroh4 UTSW 15 74,488,157 (GRCm39) missense possibly damaging 0.47
R8978:Mroh4 UTSW 15 74,499,473 (GRCm39) missense probably benign 0.00
R9004:Mroh4 UTSW 15 74,486,171 (GRCm39) missense possibly damaging 0.65
R9083:Mroh4 UTSW 15 74,498,140 (GRCm39) missense probably damaging 1.00
R9248:Mroh4 UTSW 15 74,485,167 (GRCm39) missense possibly damaging 0.59
R9320:Mroh4 UTSW 15 74,483,405 (GRCm39) missense probably damaging 1.00
R9356:Mroh4 UTSW 15 74,482,760 (GRCm39) missense probably benign 0.05
R9512:Mroh4 UTSW 15 74,485,095 (GRCm39) missense probably benign 0.18
Z1177:Mroh4 UTSW 15 74,499,851 (GRCm39) missense possibly damaging 0.83
Z1177:Mroh4 UTSW 15 74,499,569 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCTGGAGCTCTGAGTCTTG -3'
(R):5'- CACTTGCAGGAGCTTTCTGTG -3'

Sequencing Primer
(F):5'- AGCTCTGAGTCTTGAGCCC -3'
(R):5'- GGGGGCTTACTTTTCCCTCCAG -3'
Posted On 2022-02-07