Incidental Mutation 'R9172:Atp9b'
ID 696508
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene Name ATPase, class II, type 9B
Synonyms IIb
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9172 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 80777356-80977275 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 80960993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 73 (R73*)
Ref Sequence ENSEMBL: ENSMUSP00000089394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225205] [ENSMUST00000225235] [ENSMUST00000225980] [ENSMUST00000226064]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000091790
AA Change: R73*
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: R73*

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224709
Predicted Effect probably null
Transcript: ENSMUST00000225205
AA Change: R73*
Predicted Effect probably null
Transcript: ENSMUST00000225235
AA Change: R73*
Predicted Effect probably null
Transcript: ENSMUST00000225980
AA Change: R73*
Predicted Effect probably benign
Transcript: ENSMUST00000226064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,691,833 (GRCm39) L332Q probably damaging Het
Adcy1 A G 11: 7,110,317 (GRCm39) N855D probably damaging Het
Adgrl3 T A 5: 81,922,251 (GRCm39) C1199S probably benign Het
Alyref G A 11: 120,486,842 (GRCm39) R140C probably benign Het
Arhgap26 A T 18: 39,378,382 (GRCm39) I92F probably damaging Het
Btaf1 G A 19: 36,977,630 (GRCm39) A1483T probably damaging Het
Cmtr2 T C 8: 110,948,761 (GRCm39) L357P probably damaging Het
Commd7 A T 2: 153,470,474 (GRCm39) L51Q possibly damaging Het
Cpd T A 11: 76,675,252 (GRCm39) I1290L probably benign Het
Cry2 C A 2: 92,243,993 (GRCm39) E393D probably damaging Het
Ctsm A T 13: 61,685,643 (GRCm39) M74K Het
Dnai7 A G 6: 145,123,175 (GRCm39) F564L probably benign Het
Dync2h1 T C 9: 7,031,771 (GRCm39) Y3491C probably damaging Het
Erc1 A C 6: 119,801,842 (GRCm39) N58K possibly damaging Het
Fbxw21 T C 9: 108,975,764 (GRCm39) T211A probably benign Het
Fcsk A G 8: 111,610,557 (GRCm39) W949R probably damaging Het
Fry T C 5: 150,336,793 (GRCm39) V1388A probably benign Het
Gca T G 2: 62,520,368 (GRCm39) I176S probably damaging Het
Gimap7 A T 6: 48,700,761 (GRCm39) K116* probably null Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,447 (GRCm39) probably benign Het
Gm9195 A C 14: 72,711,154 (GRCm39) L428R probably damaging Het
Grin2b A G 6: 135,756,255 (GRCm39) I490T possibly damaging Het
Kif24 T C 4: 41,400,442 (GRCm39) T499A probably benign Het
Mbtps1 G A 8: 120,260,108 (GRCm39) T413I probably damaging Het
Med4 A T 14: 73,751,365 (GRCm39) S105C probably benign Het
Mgat1 G A 11: 49,151,910 (GRCm39) R131Q probably damaging Het
Mroh4 T C 15: 74,477,961 (GRCm39) *984W probably null Het
Mybpc1 T C 10: 88,379,615 (GRCm39) E628G possibly damaging Het
Myh8 C T 11: 67,183,260 (GRCm39) P713L possibly damaging Het
Myo7a T C 7: 97,732,369 (GRCm39) D706G probably benign Het
Nbas T A 12: 13,424,751 (GRCm39) C997S possibly damaging Het
Nkx2-1 C A 12: 56,581,752 (GRCm39) G32C probably damaging Het
Npas3 A G 12: 54,112,653 (GRCm39) T466A probably benign Het
Opa1 C T 16: 29,439,232 (GRCm39) R683C probably benign Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or5p63 T C 7: 107,811,169 (GRCm39) E189G probably benign Het
Or8k38 T A 2: 86,487,879 (GRCm39) I308L probably benign Het
Ppfibp2 T A 7: 107,337,525 (GRCm39) L609* probably null Het
Pygo2 T A 3: 89,340,617 (GRCm39) D338E possibly damaging Het
Pzp A T 6: 128,502,172 (GRCm39) M59K probably benign Het
Reln A G 5: 22,155,815 (GRCm39) probably null Het
Ripor1 A G 8: 106,347,833 (GRCm39) D1097G unknown Het
Rmdn3 T C 2: 118,968,863 (GRCm39) K443E probably benign Het
Rnf145 A G 11: 44,448,262 (GRCm39) D373G possibly damaging Het
Sec23b A T 2: 144,401,179 (GRCm39) E13D probably benign Het
Semp2l1 G T 1: 32,585,165 (GRCm39) H248Q probably benign Het
Slc39a6 A G 18: 24,715,399 (GRCm39) F707S probably damaging Het
Sox11 G A 12: 27,391,536 (GRCm39) A291V possibly damaging Het
Spart T A 3: 55,032,267 (GRCm39) V367D possibly damaging Het
Spata31e3 A G 13: 50,401,417 (GRCm39) F303S probably benign Het
Strap A T 6: 137,718,365 (GRCm39) K156N probably benign Het
Stxbp5 T A 10: 9,645,152 (GRCm39) I951F possibly damaging Het
Taar7a T C 10: 23,868,677 (GRCm39) I235V probably benign Het
Tek T A 4: 94,692,583 (GRCm39) N230K probably benign Het
Tyw1 T A 5: 130,325,520 (GRCm39) C469* probably null Het
Vcan T C 13: 89,828,050 (GRCm39) H3132R probably damaging Het
Vmn2r24 A G 6: 123,783,432 (GRCm39) D544G probably damaging Het
Vmn2r3 A T 3: 64,186,403 (GRCm39) M94K possibly damaging Het
Vps33a T C 5: 123,674,604 (GRCm39) T388A probably benign Het
Vta1 A G 10: 14,551,743 (GRCm39) I152T probably damaging Het
Vtcn1 A G 3: 100,799,865 (GRCm39) D242G probably benign Het
Zfp12 T A 5: 143,231,220 (GRCm39) C548S probably damaging Het
Zfp263 A G 16: 3,567,323 (GRCm39) D546G probably benign Het
Zfp324 T A 7: 12,704,689 (GRCm39) C293S probably damaging Het
Zfp747l1 T C 7: 126,984,626 (GRCm39) K159E probably benign Het
Zscan4c A T 7: 10,743,819 (GRCm39) I473F possibly damaging Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80,961,103 (GRCm39) intron probably benign
IGL00769:Atp9b APN 18 80,956,068 (GRCm39) missense probably benign 0.08
IGL00851:Atp9b APN 18 80,809,125 (GRCm39) missense probably damaging 1.00
IGL01529:Atp9b APN 18 80,887,826 (GRCm39) intron probably benign
IGL01637:Atp9b APN 18 80,799,670 (GRCm39) missense probably benign 0.06
IGL01973:Atp9b APN 18 80,801,518 (GRCm39) missense probably benign 0.02
IGL02082:Atp9b APN 18 80,935,145 (GRCm39) intron probably benign
IGL02560:Atp9b APN 18 80,805,413 (GRCm39) missense probably benign 0.23
IGL02981:Atp9b APN 18 80,797,504 (GRCm39) missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80,820,065 (GRCm39) missense probably benign 0.28
IGL03304:Atp9b APN 18 80,961,092 (GRCm39) missense probably damaging 1.00
IGL03348:Atp9b APN 18 80,879,637 (GRCm39) missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80,809,018 (GRCm39) missense probably damaging 0.99
R0355:Atp9b UTSW 18 80,952,800 (GRCm39) intron probably benign
R0366:Atp9b UTSW 18 80,805,317 (GRCm39) missense probably damaging 1.00
R0557:Atp9b UTSW 18 80,809,137 (GRCm39) missense probably damaging 1.00
R0612:Atp9b UTSW 18 80,797,171 (GRCm39) missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80,901,841 (GRCm39) missense probably damaging 1.00
R1126:Atp9b UTSW 18 80,822,169 (GRCm39) missense probably damaging 1.00
R1499:Atp9b UTSW 18 80,822,122 (GRCm39) missense probably benign 0.02
R1499:Atp9b UTSW 18 80,805,353 (GRCm39) missense probably damaging 0.99
R1764:Atp9b UTSW 18 80,952,806 (GRCm39) critical splice donor site probably null
R1780:Atp9b UTSW 18 80,820,112 (GRCm39) nonsense probably null
R1782:Atp9b UTSW 18 80,809,137 (GRCm39) missense probably damaging 1.00
R1835:Atp9b UTSW 18 80,822,098 (GRCm39) missense probably benign 0.00
R1859:Atp9b UTSW 18 80,793,135 (GRCm39) missense possibly damaging 0.95
R1953:Atp9b UTSW 18 80,797,522 (GRCm39) missense possibly damaging 0.80
R2140:Atp9b UTSW 18 80,779,302 (GRCm39) missense probably damaging 0.99
R2191:Atp9b UTSW 18 80,796,266 (GRCm39) missense probably damaging 1.00
R4118:Atp9b UTSW 18 80,793,044 (GRCm39) missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80,796,364 (GRCm39) critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80,935,093 (GRCm39) missense probably benign 0.00
R4767:Atp9b UTSW 18 80,796,285 (GRCm39) missense probably damaging 1.00
R4775:Atp9b UTSW 18 80,808,984 (GRCm39) critical splice donor site probably null
R4936:Atp9b UTSW 18 80,779,308 (GRCm39) missense possibly damaging 0.58
R5096:Atp9b UTSW 18 80,805,399 (GRCm39) missense probably benign 0.39
R5279:Atp9b UTSW 18 80,956,073 (GRCm39) missense probably damaging 0.98
R5394:Atp9b UTSW 18 80,820,052 (GRCm39) missense probably benign 0.16
R5774:Atp9b UTSW 18 80,977,147 (GRCm39) missense probably damaging 0.96
R5877:Atp9b UTSW 18 80,796,004 (GRCm39) missense probably benign
R6080:Atp9b UTSW 18 80,782,023 (GRCm39) missense probably benign 0.03
R6170:Atp9b UTSW 18 80,920,562 (GRCm39) missense probably benign 0.16
R6250:Atp9b UTSW 18 80,799,736 (GRCm39) missense probably benign 0.01
R6340:Atp9b UTSW 18 80,822,115 (GRCm39) missense probably benign 0.38
R6498:Atp9b UTSW 18 80,820,230 (GRCm39) missense probably benign 0.03
R6620:Atp9b UTSW 18 80,851,902 (GRCm39) nonsense probably null
R6632:Atp9b UTSW 18 80,851,864 (GRCm39) missense probably damaging 1.00
R6665:Atp9b UTSW 18 80,960,950 (GRCm39) missense probably benign 0.26
R6821:Atp9b UTSW 18 80,890,463 (GRCm39) missense probably damaging 1.00
R6927:Atp9b UTSW 18 80,935,072 (GRCm39) missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80,796,317 (GRCm39) missense probably damaging 1.00
R7133:Atp9b UTSW 18 80,952,871 (GRCm39) missense
R7188:Atp9b UTSW 18 80,961,041 (GRCm39) missense
R7396:Atp9b UTSW 18 80,780,057 (GRCm39) missense
R7432:Atp9b UTSW 18 80,809,056 (GRCm39) missense
R7457:Atp9b UTSW 18 80,960,833 (GRCm39) splice site probably null
R7877:Atp9b UTSW 18 80,890,412 (GRCm39) missense
R8072:Atp9b UTSW 18 80,808,276 (GRCm39) missense
R8167:Atp9b UTSW 18 80,890,398 (GRCm39) missense
R8420:Atp9b UTSW 18 80,887,806 (GRCm39) missense
R8700:Atp9b UTSW 18 80,796,361 (GRCm39) missense
R8830:Atp9b UTSW 18 80,809,015 (GRCm39) missense
R8884:Atp9b UTSW 18 80,838,562 (GRCm39) missense
R9463:Atp9b UTSW 18 80,809,051 (GRCm39) missense
R9735:Atp9b UTSW 18 80,838,629 (GRCm39) missense
Z1176:Atp9b UTSW 18 80,809,080 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCCCTTTCAGAACAGCATCC -3'
(R):5'- TGGCCTGATGTTATTCCAGATGAAATG -3'

Sequencing Primer
(F):5'- GTTGCTAGTATCCTCCACAATGACAG -3'
(R):5'- GTACTGTAACAGAAGACTGCTTAGC -3'
Posted On 2022-02-07