Incidental Mutation 'R9173:Map6'
ID 696537
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 068947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9173 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98917935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 236 (R236H)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: R236H

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107100
AA Change: R33H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: R33H

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: R236H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: R236H

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208605
AA Change: R33H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: R33H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a G T 9: 119,170,190 (GRCm39) probably benign Het
Clstn1 A G 4: 149,710,564 (GRCm39) T79A probably benign Het
Cpd C T 11: 76,699,649 (GRCm39) R634Q probably damaging Het
Ctnna2 T C 6: 76,896,939 (GRCm39) D753G probably damaging Het
Cyp51 T C 5: 4,136,504 (GRCm39) N430S probably benign Het
Dnajc17 A T 2: 119,009,894 (GRCm39) V244D probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Dysf A G 6: 84,171,379 (GRCm39) K1796E probably benign Het
Eftud2 A T 11: 102,734,242 (GRCm39) V659E probably damaging Het
Ercc4 G A 16: 12,939,973 (GRCm39) A168T possibly damaging Het
Exd2 T C 12: 80,536,236 (GRCm39) Y289H probably benign Het
Fat2 C A 11: 55,169,763 (GRCm39) V2999L probably damaging Het
Fgd5 T C 6: 92,044,584 (GRCm39) probably null Het
Fkbp9 T C 6: 56,850,389 (GRCm39) S422P possibly damaging Het
H2bc21 T C 3: 96,128,615 (GRCm39) V45A possibly damaging Het
H2-Eb2 A G 17: 34,552,491 (GRCm39) D112G probably benign Het
Herc2 A T 7: 55,856,350 (GRCm39) R3929S probably damaging Het
Hrc G A 7: 44,986,799 (GRCm39) probably null Het
Ighv5-8 T A 12: 113,618,681 (GRCm39) V32D probably benign Het
Itgal G T 7: 126,896,789 (GRCm39) probably null Het
Jcad T A 18: 4,675,820 (GRCm39) V1194E probably benign Het
Kat8 A G 7: 127,511,863 (GRCm39) T54A probably benign Het
Kcnu1 G A 8: 26,390,074 (GRCm39) probably null Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Lama1 A G 17: 68,076,597 (GRCm39) T1124A Het
Lrp2 T A 2: 69,299,731 (GRCm39) D3107V probably damaging Het
Mycbpap T A 11: 94,397,209 (GRCm39) N64I probably damaging Het
Nop14 A G 5: 34,806,776 (GRCm39) S443P probably damaging Het
Nxn T C 11: 76,149,560 (GRCm39) D380G possibly damaging Het
Or1e28-ps1 T A 11: 73,615,734 (GRCm39) I39F possibly damaging Het
Patj A T 4: 98,526,958 (GRCm39) M1390L probably benign Het
Pcyox1l A G 18: 61,830,663 (GRCm39) L403P probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkhd1l1 A G 15: 44,384,152 (GRCm39) S1181G probably benign Het
Prom1 A T 5: 44,220,520 (GRCm39) I76N possibly damaging Het
Relch A G 1: 105,678,128 (GRCm39) E1151G probably benign Het
Rnft1 T C 11: 86,377,001 (GRCm39) S22P probably benign Het
Sec31a T C 5: 100,529,147 (GRCm39) T733A possibly damaging Het
Serpina1c A G 12: 103,862,328 (GRCm39) I329T possibly damaging Het
Slco1a4 T C 6: 141,761,299 (GRCm39) D438G probably benign Het
Slit2 G A 5: 48,377,285 (GRCm39) C438Y probably damaging Het
Sorcs1 T A 19: 50,220,753 (GRCm39) I566F possibly damaging Het
Spata31e5 T A 1: 28,816,430 (GRCm39) E534V probably benign Het
Spata7 T A 12: 98,603,853 (GRCm39) S73R probably damaging Het
Stau2 G A 1: 16,444,933 (GRCm39) R332* probably null Het
Sytl3 T C 17: 7,000,471 (GRCm39) F419L probably damaging Het
Tet1 A C 10: 62,676,065 (GRCm39) D670E probably benign Het
Trafd1 T C 5: 121,516,598 (GRCm39) R202G possibly damaging Het
Tubal3 A T 13: 3,983,050 (GRCm39) T277S possibly damaging Het
Ube4b A G 4: 149,415,933 (GRCm39) F1054L probably damaging Het
Unc13b C A 4: 43,177,421 (GRCm39) Q2750K unknown Het
Usp29 T C 7: 6,964,636 (GRCm39) S160P possibly damaging Het
Vmn2r114 A T 17: 23,510,527 (GRCm39) I651N probably damaging Het
Ypel1 A T 16: 16,915,298 (GRCm39) C103* probably null Het
Zfp11 A T 5: 129,734,891 (GRCm39) I190N probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCAGTACCAGAAGGACTTC -3'
(R):5'- TGTGTCACGCTGATCTGCAC -3'

Sequencing Primer
(F):5'- GGTGCAAATCCCTGCGACTTC -3'
(R):5'- TTTCCAGCTGCAGGACCAC -3'
Posted On 2022-02-07