Incidental Mutation 'R9173:Map6'
ID 696537
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9173 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99268728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 236 (R236H)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: R236H

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107100
AA Change: R33H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: R33H

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: R236H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: R236H

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: R236H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208605
AA Change: R33H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: R33H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,403 E1151G probably benign Het
Acaa1a G T 9: 119,341,124 probably benign Het
Clstn1 A G 4: 149,626,107 T79A probably benign Het
Cpd C T 11: 76,808,823 R634Q probably damaging Het
Ctnna2 T C 6: 76,919,956 D753G probably damaging Het
Cyp51 T C 5: 4,086,504 N430S probably benign Het
Dnajc17 A T 2: 119,179,413 V244D probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Dysf A G 6: 84,194,397 K1796E probably benign Het
Eftud2 A T 11: 102,843,416 V659E probably damaging Het
Ercc4 G A 16: 13,122,109 A168T possibly damaging Het
Exd2 T C 12: 80,489,462 Y289H probably benign Het
Fat2 C A 11: 55,278,937 V2999L probably damaging Het
Fgd5 T C 6: 92,067,603 probably null Het
Fkbp9 T C 6: 56,873,404 S422P possibly damaging Het
Gm597 T A 1: 28,777,349 E534V probably benign Het
H2-Eb2 A G 17: 34,333,517 D112G probably benign Het
Herc2 A T 7: 56,206,602 R3929S probably damaging Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Hrc G A 7: 45,337,375 probably null Het
Ighv5-8 T A 12: 113,655,061 V32D probably benign Het
Itgal G T 7: 127,297,617 probably null Het
Jcad T A 18: 4,675,820 V1194E probably benign Het
Kat8 A G 7: 127,912,691 T54A probably benign Het
Kcnu1 G A 8: 25,900,046 probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lama1 A G 17: 67,769,602 T1124A Het
Lrp2 T A 2: 69,469,387 D3107V probably damaging Het
Mycbpap T A 11: 94,506,383 N64I probably damaging Het
Nop14 A G 5: 34,649,432 S443P probably damaging Het
Nxn T C 11: 76,258,734 D380G possibly damaging Het
Olfr388-ps1 T A 11: 73,724,908 I39F possibly damaging Het
Patj A T 4: 98,638,721 M1390L probably benign Het
Pcyox1l A G 18: 61,697,592 L403P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkhd1l1 A G 15: 44,520,756 S1181G probably benign Het
Ppil2 A T 16: 17,097,434 C103* probably null Het
Prom1 A T 5: 44,063,178 I76N possibly damaging Het
Rnft1 T C 11: 86,486,175 S22P probably benign Het
Sec31a T C 5: 100,381,288 T733A possibly damaging Het
Serpina1c A G 12: 103,896,069 I329T possibly damaging Het
Slco1a4 T C 6: 141,815,573 D438G probably benign Het
Slit2 G A 5: 48,219,943 C438Y probably damaging Het
Sorcs1 T A 19: 50,232,315 I566F possibly damaging Het
Spata7 T A 12: 98,637,594 S73R probably damaging Het
Stau2 G A 1: 16,374,709 R332* probably null Het
Sytl3 T C 17: 6,733,072 F419L probably damaging Het
Tet1 A C 10: 62,840,286 D670E probably benign Het
Trafd1 T C 5: 121,378,535 R202G possibly damaging Het
Tubal3 A T 13: 3,933,050 T277S possibly damaging Het
Ube4b A G 4: 149,331,476 F1054L probably damaging Het
Unc13b C A 4: 43,177,421 Q2750K unknown Het
Usp29 T C 7: 6,961,637 S160P possibly damaging Het
Vmn2r114 A T 17: 23,291,553 I651N probably damaging Het
Zfp11 A T 5: 129,657,827 I190N probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCAGTACCAGAAGGACTTC -3'
(R):5'- TGTGTCACGCTGATCTGCAC -3'

Sequencing Primer
(F):5'- GGTGCAAATCCCTGCGACTTC -3'
(R):5'- TTTCCAGCTGCAGGACCAC -3'
Posted On 2022-02-07