Incidental Mutation 'R9173:Cpd'
ID 696546
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Name carboxypeptidase D
Synonyms D830034L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock # R9173 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 76778424-76847018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 76808823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 634 (R634Q)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
AlphaFold O89001
Predicted Effect probably damaging
Transcript: ENSMUST00000021201
AA Change: R634Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: R634Q

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,403 E1151G probably benign Het
Acaa1a G T 9: 119,341,124 probably benign Het
Clstn1 A G 4: 149,626,107 T79A probably benign Het
Ctnna2 T C 6: 76,919,956 D753G probably damaging Het
Cyp51 T C 5: 4,086,504 N430S probably benign Het
Dnajc17 A T 2: 119,179,413 V244D probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Dysf A G 6: 84,194,397 K1796E probably benign Het
Eftud2 A T 11: 102,843,416 V659E probably damaging Het
Ercc4 G A 16: 13,122,109 A168T possibly damaging Het
Exd2 T C 12: 80,489,462 Y289H probably benign Het
Fat2 C A 11: 55,278,937 V2999L probably damaging Het
Fgd5 T C 6: 92,067,603 probably null Het
Fkbp9 T C 6: 56,873,404 S422P possibly damaging Het
Gm597 T A 1: 28,777,349 E534V probably benign Het
H2-Eb2 A G 17: 34,333,517 D112G probably benign Het
Herc2 A T 7: 56,206,602 R3929S probably damaging Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Hrc G A 7: 45,337,375 probably null Het
Ighv5-8 T A 12: 113,655,061 V32D probably benign Het
Itgal G T 7: 127,297,617 probably null Het
Jcad T A 18: 4,675,820 V1194E probably benign Het
Kat8 A G 7: 127,912,691 T54A probably benign Het
Kcnu1 G A 8: 25,900,046 probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lama1 A G 17: 67,769,602 T1124A Het
Lrp2 T A 2: 69,469,387 D3107V probably damaging Het
Map6 G A 7: 99,268,728 R236H probably damaging Het
Mycbpap T A 11: 94,506,383 N64I probably damaging Het
Nop14 A G 5: 34,649,432 S443P probably damaging Het
Nxn T C 11: 76,258,734 D380G possibly damaging Het
Olfr388-ps1 T A 11: 73,724,908 I39F possibly damaging Het
Patj A T 4: 98,638,721 M1390L probably benign Het
Pcyox1l A G 18: 61,697,592 L403P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkhd1l1 A G 15: 44,520,756 S1181G probably benign Het
Ppil2 A T 16: 17,097,434 C103* probably null Het
Prom1 A T 5: 44,063,178 I76N possibly damaging Het
Rnft1 T C 11: 86,486,175 S22P probably benign Het
Sec31a T C 5: 100,381,288 T733A possibly damaging Het
Serpina1c A G 12: 103,896,069 I329T possibly damaging Het
Slco1a4 T C 6: 141,815,573 D438G probably benign Het
Slit2 G A 5: 48,219,943 C438Y probably damaging Het
Sorcs1 T A 19: 50,232,315 I566F possibly damaging Het
Spata7 T A 12: 98,637,594 S73R probably damaging Het
Stau2 G A 1: 16,374,709 R332* probably null Het
Sytl3 T C 17: 6,733,072 F419L probably damaging Het
Tet1 A C 10: 62,840,286 D670E probably benign Het
Trafd1 T C 5: 121,378,535 R202G possibly damaging Het
Tubal3 A T 13: 3,933,050 T277S possibly damaging Het
Ube4b A G 4: 149,331,476 F1054L probably damaging Het
Unc13b C A 4: 43,177,421 Q2750K unknown Het
Usp29 T C 7: 6,961,637 S160P possibly damaging Het
Vmn2r114 A T 17: 23,291,553 I651N probably damaging Het
Zfp11 A T 5: 129,657,827 I190N probably damaging Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
R8935:Cpd UTSW 11 76840469 missense probably damaging 1.00
R9151:Cpd UTSW 11 76784449 missense possibly damaging 0.54
R9172:Cpd UTSW 11 76784426 missense probably benign 0.21
R9310:Cpd UTSW 11 76814781 nonsense probably null
R9666:Cpd UTSW 11 76802307 missense probably benign 0.02
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCACTTGAAGGAAGCCTAGG -3'
(R):5'- TCACTCATTGGGATTGGTAGC -3'

Sequencing Primer
(F):5'- TCACTTGAAGGAAGCCTAGGACTTC -3'
(R):5'- ACTCATTGGGATTGGTAGCAGTGAG -3'
Posted On 2022-02-07