Incidental Mutation 'R9173:Sorcs1'
ID 696564
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 068947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9173 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50220753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 566 (I566F)
Ref Sequence ENSEMBL: ENSMUSP00000147463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000072685
AA Change: I566F

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: I566F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: I566F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: I566F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: I566F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: I566F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: I566F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209783
AA Change: I566F

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: I566F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: I566F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a G T 9: 119,170,190 (GRCm39) probably benign Het
Clstn1 A G 4: 149,710,564 (GRCm39) T79A probably benign Het
Cpd C T 11: 76,699,649 (GRCm39) R634Q probably damaging Het
Ctnna2 T C 6: 76,896,939 (GRCm39) D753G probably damaging Het
Cyp51 T C 5: 4,136,504 (GRCm39) N430S probably benign Het
Dnajc17 A T 2: 119,009,894 (GRCm39) V244D probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Dysf A G 6: 84,171,379 (GRCm39) K1796E probably benign Het
Eftud2 A T 11: 102,734,242 (GRCm39) V659E probably damaging Het
Ercc4 G A 16: 12,939,973 (GRCm39) A168T possibly damaging Het
Exd2 T C 12: 80,536,236 (GRCm39) Y289H probably benign Het
Fat2 C A 11: 55,169,763 (GRCm39) V2999L probably damaging Het
Fgd5 T C 6: 92,044,584 (GRCm39) probably null Het
Fkbp9 T C 6: 56,850,389 (GRCm39) S422P possibly damaging Het
H2bc21 T C 3: 96,128,615 (GRCm39) V45A possibly damaging Het
H2-Eb2 A G 17: 34,552,491 (GRCm39) D112G probably benign Het
Herc2 A T 7: 55,856,350 (GRCm39) R3929S probably damaging Het
Hrc G A 7: 44,986,799 (GRCm39) probably null Het
Ighv5-8 T A 12: 113,618,681 (GRCm39) V32D probably benign Het
Itgal G T 7: 126,896,789 (GRCm39) probably null Het
Jcad T A 18: 4,675,820 (GRCm39) V1194E probably benign Het
Kat8 A G 7: 127,511,863 (GRCm39) T54A probably benign Het
Kcnu1 G A 8: 26,390,074 (GRCm39) probably null Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Lama1 A G 17: 68,076,597 (GRCm39) T1124A Het
Lrp2 T A 2: 69,299,731 (GRCm39) D3107V probably damaging Het
Map6 G A 7: 98,917,935 (GRCm39) R236H probably damaging Het
Mycbpap T A 11: 94,397,209 (GRCm39) N64I probably damaging Het
Nop14 A G 5: 34,806,776 (GRCm39) S443P probably damaging Het
Nxn T C 11: 76,149,560 (GRCm39) D380G possibly damaging Het
Or1e28-ps1 T A 11: 73,615,734 (GRCm39) I39F possibly damaging Het
Patj A T 4: 98,526,958 (GRCm39) M1390L probably benign Het
Pcyox1l A G 18: 61,830,663 (GRCm39) L403P probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkhd1l1 A G 15: 44,384,152 (GRCm39) S1181G probably benign Het
Prom1 A T 5: 44,220,520 (GRCm39) I76N possibly damaging Het
Relch A G 1: 105,678,128 (GRCm39) E1151G probably benign Het
Rnft1 T C 11: 86,377,001 (GRCm39) S22P probably benign Het
Sec31a T C 5: 100,529,147 (GRCm39) T733A possibly damaging Het
Serpina1c A G 12: 103,862,328 (GRCm39) I329T possibly damaging Het
Slco1a4 T C 6: 141,761,299 (GRCm39) D438G probably benign Het
Slit2 G A 5: 48,377,285 (GRCm39) C438Y probably damaging Het
Spata31e5 T A 1: 28,816,430 (GRCm39) E534V probably benign Het
Spata7 T A 12: 98,603,853 (GRCm39) S73R probably damaging Het
Stau2 G A 1: 16,444,933 (GRCm39) R332* probably null Het
Sytl3 T C 17: 7,000,471 (GRCm39) F419L probably damaging Het
Tet1 A C 10: 62,676,065 (GRCm39) D670E probably benign Het
Trafd1 T C 5: 121,516,598 (GRCm39) R202G possibly damaging Het
Tubal3 A T 13: 3,983,050 (GRCm39) T277S possibly damaging Het
Ube4b A G 4: 149,415,933 (GRCm39) F1054L probably damaging Het
Unc13b C A 4: 43,177,421 (GRCm39) Q2750K unknown Het
Usp29 T C 7: 6,964,636 (GRCm39) S160P possibly damaging Het
Vmn2r114 A T 17: 23,510,527 (GRCm39) I651N probably damaging Het
Ypel1 A T 16: 16,915,298 (GRCm39) C103* probably null Het
Zfp11 A T 5: 129,734,891 (GRCm39) I190N probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGTTTGGTTCACTTCAGAC -3'
(R):5'- AAACCGTTGACCTTGAAGTAAGTC -3'

Sequencing Primer
(F):5'- CACTTCAGACTTGCATTACAAAGAG -3'
(R):5'- GTTGACCTTGAAGTAAGTCTACTTAG -3'
Posted On 2022-02-07