Incidental Mutation 'R9174:H2-M9'
ID 696598
Institutional Source Beutler Lab
Gene Symbol H2-M9
Ensembl Gene ENSMUSG00000067201
Gene Name histocompatibility 2, M region locus 9
Synonyms M9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9174 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 36639285-36642666 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 36642289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 42 (L42R)
Ref Sequence ENSEMBL: ENSMUSP00000084411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087165] [ENSMUST00000087167]
AlphaFold O19442
Predicted Effect probably damaging
Transcript: ENSMUST00000087165
AA Change: L42R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084409
Gene: ENSMUSG00000067201
AA Change: L42R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.4e-45 PFAM
transmembrane domain 216 238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087167
AA Change: L42R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084411
Gene: ENSMUSG00000067201
AA Change: L42R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 5.3e-44 PFAM
IGc1 222 293 5.73e-22 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap1 A G 11: 88,835,165 Y737H probably damaging Het
Arap2 A T 5: 62,698,263 V610E probably damaging Het
Arf1 G A 11: 59,212,607 T158I probably damaging Het
Atat1 T C 17: 35,909,140 K90R probably benign Het
Cfap70 C A 14: 20,443,638 G132W probably damaging Het
Cpne9 T A 6: 113,302,071 D475E probably damaging Het
Dapp1 T C 3: 137,933,155 D270G probably benign Het
Dnajc21 A T 15: 10,461,990 Y108* probably null Het
Etv4 A G 11: 101,771,879 probably null Het
Fes C A 7: 80,380,883 V555F probably damaging Het
Gm14496 A C 2: 182,001,004 I823L possibly damaging Het
Ifitm2 A T 7: 140,955,100 I107N probably damaging Het
Impg1 T C 9: 80,345,468 T477A probably damaging Het
Inca1 G A 11: 70,689,906 P78S possibly damaging Het
Khk A G 5: 30,928,475 E126G probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Mars A T 10: 127,299,368 I618N probably damaging Het
Mgl2 C A 11: 70,135,780 F110L probably benign Het
Mon1b A G 8: 113,639,057 D339G probably damaging Het
Pfdn2 G C 1: 171,356,596 E48Q probably damaging Het
Pilra A G 5: 137,835,636 I56T probably damaging Het
Ptpru A T 4: 131,808,435 N410K probably damaging Het
Sema3c T C 5: 17,663,041 probably null Het
Stau1 A G 2: 166,949,349 C495R probably damaging Het
Ttc37 A G 13: 76,147,774 E1052G probably benign Het
Ubap1l T A 9: 65,377,007 H339Q probably benign Het
Urb2 A G 8: 124,041,248 D1411G possibly damaging Het
Ush2a T A 1: 188,728,219 I2559N probably damaging Het
Vipas39 A T 12: 87,259,111 S103T possibly damaging Het
Vrk1 G A 12: 106,036,552 R3H probably benign Het
Wdr46 G T 17: 33,948,694 R493L possibly damaging Het
Zbtb8a T C 4: 129,360,332 D123G probably damaging Het
Other mutations in H2-M9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2-M9 APN 17 36641819 splice site probably null
IGL02133:H2-M9 APN 17 36641737 missense possibly damaging 0.95
IGL02323:H2-M9 APN 17 36640741 missense probably damaging 1.00
IGL02957:H2-M9 APN 17 36642157 missense probably benign 0.00
IGL03127:H2-M9 APN 17 36640822 missense possibly damaging 0.48
R0025:H2-M9 UTSW 17 36641755 missense probably damaging 1.00
R0026:H2-M9 UTSW 17 36641527 splice site probably benign
R0926:H2-M9 UTSW 17 36641773 missense probably damaging 0.98
R1171:H2-M9 UTSW 17 36641653 missense probably benign 0.14
R1264:H2-M9 UTSW 17 36642592 missense probably benign
R1995:H2-M9 UTSW 17 36641786 missense probably damaging 1.00
R4622:H2-M9 UTSW 17 36641824 splice site probably null
R4737:H2-M9 UTSW 17 36640739 nonsense probably null
R4808:H2-M9 UTSW 17 36640792 missense probably damaging 0.99
R5176:H2-M9 UTSW 17 36641631 missense probably damaging 0.98
R6756:H2-M9 UTSW 17 36642335 missense probably damaging 1.00
R6785:H2-M9 UTSW 17 36642233 missense probably damaging 0.99
R7216:H2-M9 UTSW 17 36640702 missense probably benign
R7464:H2-M9 UTSW 17 36642411 splice site probably null
R8079:H2-M9 UTSW 17 36642133 missense probably benign 0.39
R8688:H2-M9 UTSW 17 36642142 missense probably damaging 1.00
X0018:H2-M9 UTSW 17 36641722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCATAATTCCTGTCACGAAGC -3'
(R):5'- GTGCAGTAACTGGGAAGCATTTC -3'

Sequencing Primer
(F):5'- TTCAACCATGGTACCCGA -3'
(R):5'- GCAGTAACTGGGAAGCATTTCTCTTC -3'
Posted On 2022-02-07