Incidental Mutation 'R9175:Iqcm'
ID 696624
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene Name IQ motif containing M
Synonyms 1700007B14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9175 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 75448694-75984503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75984239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 472 (K472E)
Ref Sequence ENSEMBL: ENSMUSP00000034033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
AlphaFold Q149I8
Predicted Effect possibly damaging
Transcript: ENSMUST00000034033
AA Change: K472E

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: K472E

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121983
AA Change: K472E

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: K472E

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212704
AA Change: K472E

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,584,518 probably null Het
2900092C05Rik G A 7: 12,515,485 D82N probably benign Het
Abca13 A G 11: 9,581,593 K4607E probably damaging Het
Agpat4 G C 17: 12,198,782 G70A probably damaging Het
Ank2 G A 3: 126,928,753 T1017I possibly damaging Het
C2cd2 T C 16: 97,877,221 I339V probably benign Het
Cacna1a A T 8: 84,570,015 N1221Y probably damaging Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Ccdc74a T C 16: 17,650,178 S101P probably benign Het
Cdh13 A T 8: 119,242,229 I442F probably damaging Het
Cnot2 A T 10: 116,498,146 M373K possibly damaging Het
Coch C A 12: 51,598,277 H205N possibly damaging Het
Col6a4 A G 9: 106,080,361 V88A probably benign Het
Erich3 A G 3: 154,713,964 T35A probably benign Het
Gm28360 A T 1: 117,853,598 K106N possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspg2 T C 4: 137,529,346 F1467L probably damaging Het
Ighg2c T C 12: 113,288,879 T18A Het
Kcnk5 A T 14: 20,142,049 V348D probably benign Het
Kcns3 C T 12: 11,119,800 probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Muc5ac A G 7: 141,812,356 D2787G possibly damaging Het
Nasp A G 4: 116,614,379 C84R probably damaging Het
Nfia G A 4: 97,783,125 R24H probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr330 T C 11: 58,529,764 D74G probably damaging Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Papd7 A G 13: 69,515,796 L268P probably damaging Het
Pdia4 A C 6: 47,798,483 S464R possibly damaging Het
Rab3gap2 A G 1: 185,277,163 D1092G probably damaging Het
Rev3l A G 10: 39,854,768 K2763E possibly damaging Het
Sorbs1 A T 19: 40,326,574 L598Q probably damaging Het
Sppl2b A T 10: 80,862,973 M154L probably benign Het
Stk33 A G 7: 109,321,517 I331T probably damaging Het
Strip2 A G 6: 29,933,036 E494G probably benign Het
Supt6 C T 11: 78,221,226 R1010Q possibly damaging Het
Tada1 G A 1: 166,382,436 R69H probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tomm34 A G 2: 164,070,465 probably null Het
Tpi1 T C 6: 124,811,908 T223A probably damaging Het
Trpc3 T A 3: 36,655,130 N399I probably benign Het
Vgll2 A G 10: 52,027,539 H166R probably damaging Het
Vmn2r107 A T 17: 20,356,789 I350F possibly damaging Het
Vmn2r114 T A 17: 23,308,238 K440M probably damaging Het
Vmn2r55 T C 7: 12,651,866 Y729C possibly damaging Het
Zfp106 G T 2: 120,522,716 A1554E probably damaging Het
Zfyve27 A G 19: 42,181,558 Y176C probably damaging Het
Zswim5 T A 4: 116,965,744 N470K probably benign Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
R8703:Iqcm UTSW 8 75888643 missense probably damaging 1.00
R9475:Iqcm UTSW 8 75753455 missense probably damaging 1.00
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCAACAATGACTTTGGAGTGTC -3'
(R):5'- CTTGTCAACATCCAAAGATTTCACC -3'

Sequencing Primer
(F):5'- CAATGACTTTGGAGTGTCAATTGAC -3'
(R):5'- ACCCTTTATCCTGTCAATAGCAAATC -3'
Posted On 2022-02-07