Mutagenetix > Incidental Mutation

Incidental Mutation 'R9175:Sppl2b'

696630

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R9175 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80862973 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 154 (M154L)

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]

AlphaFold

Q3TD49

Predicted Effect

probably benign
Transcript: ENSMUST00000035597
AA Change: M154L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: M154L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219951

Predicted Effect

probably benign
Transcript: ENSMUST00000220091
AA Change: M1L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,584,518		probably null	Het
2900092C05Rik	G	A	7: 12,515,485	D82N	probably benign	Het
Abca13	A	G	11: 9,581,593	K4607E	probably damaging	Het
Agpat4	G	C	17: 12,198,782	G70A	probably damaging	Het
Ank2	G	A	3: 126,928,753	T1017I	possibly damaging	Het
C2cd2	T	C	16: 97,877,221	I339V	probably benign	Het
Cacna1a	A	T	8: 84,570,015	N1221Y	probably damaging	Het
Cacna1e	A	G	1: 154,398,568	V2197A	probably damaging	Het
Ccdc74a	T	C	16: 17,650,178	S101P	probably benign	Het
Cdh13	A	T	8: 119,242,229	I442F	probably damaging	Het
Cnot2	A	T	10: 116,498,146	M373K	possibly damaging	Het
Coch	C	A	12: 51,598,277	H205N	possibly damaging	Het
Col6a4	A	G	9: 106,080,361	V88A	probably benign	Het
Erich3	A	G	3: 154,713,964	T35A	probably benign	Het
Gm28360	A	T	1: 117,853,598	K106N	possibly damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Hspg2	T	C	4: 137,529,346	F1467L	probably damaging	Het
Ighg2c	T	C	12: 113,288,879	T18A		Het
Iqcm	A	G	8: 75,984,239	K472E	possibly damaging	Het
Kcnk5	A	T	14: 20,142,049	V348D	probably benign	Het
Kcns3	C	T	12: 11,119,800		probably benign	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Muc5ac	A	G	7: 141,812,356	D2787G	possibly damaging	Het
Nasp	A	G	4: 116,614,379	C84R	probably damaging	Het
Nfia	G	A	4: 97,783,125	R24H	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr330	T	C	11: 58,529,764	D74G	probably damaging	Het
Opa3	C	T	7: 19,255,541	R110C	probably damaging	Het
Papd7	A	G	13: 69,515,796	L268P	probably damaging	Het
Pdia4	A	C	6: 47,798,483	S464R	possibly damaging	Het
Rab3gap2	A	G	1: 185,277,163	D1092G	probably damaging	Het
Rev3l	A	G	10: 39,854,768	K2763E	possibly damaging	Het
Sorbs1	A	T	19: 40,326,574	L598Q	probably damaging	Het
Stk33	A	G	7: 109,321,517	I331T	probably damaging	Het
Strip2	A	G	6: 29,933,036	E494G	probably benign	Het
Supt6	C	T	11: 78,221,226	R1010Q	possibly damaging	Het
Tada1	G	A	1: 166,382,436	R69H	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tomm34	A	G	2: 164,070,465		probably null	Het
Tpi1	T	C	6: 124,811,908	T223A	probably damaging	Het
Trpc3	T	A	3: 36,655,130	N399I	probably benign	Het
Vgll2	A	G	10: 52,027,539	H166R	probably damaging	Het
Vmn2r107	A	T	17: 20,356,789	I350F	possibly damaging	Het
Vmn2r114	T	A	17: 23,308,238	K440M	probably damaging	Het
Vmn2r55	T	C	7: 12,651,866	Y729C	possibly damaging	Het
Zfp106	G	T	2: 120,522,716	A1554E	probably damaging	Het
Zfyve27	A	G	19: 42,181,558	Y176C	probably damaging	Het
Zswim5	T	A	4: 116,965,744	N470K	probably benign	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R3106:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8212:Sppl2b	UTSW	10	80865359	missense	probably damaging	1.00
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8367:Sppl2b	UTSW	10	80863191	missense	probably benign	0.02
R8398:Sppl2b	UTSW	10	80866068	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8480:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- CAAGACATCTTCAGGGTAGGC -3'
(R):5'- TGGAAAACATCGGGGTCAC -3'

Sequencing Primer
(F):5'- ATCTTCAGGGTAGGCGGCAG -3'
(R):5'- CAGGGCCATGGCTTCCAC -3'

Posted On

2022-02-07