Incidental Mutation 'R9175:0610010F05Rik'
ID 696633
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene Name RIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock # R9175 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23564961-23633639 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 23584518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
AlphaFold Q68FF0
Predicted Effect probably benign
Transcript: ENSMUST00000043356
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093267
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155903
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180260
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G A 7: 12,515,485 D82N probably benign Het
Abca13 A G 11: 9,581,593 K4607E probably damaging Het
Agpat4 G C 17: 12,198,782 G70A probably damaging Het
Ank2 G A 3: 126,928,753 T1017I possibly damaging Het
C2cd2 T C 16: 97,877,221 I339V probably benign Het
Cacna1a A T 8: 84,570,015 N1221Y probably damaging Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Ccdc74a T C 16: 17,650,178 S101P probably benign Het
Cdh13 A T 8: 119,242,229 I442F probably damaging Het
Cnot2 A T 10: 116,498,146 M373K possibly damaging Het
Coch C A 12: 51,598,277 H205N possibly damaging Het
Col6a4 A G 9: 106,080,361 V88A probably benign Het
Erich3 A G 3: 154,713,964 T35A probably benign Het
Gm28360 A T 1: 117,853,598 K106N possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspg2 T C 4: 137,529,346 F1467L probably damaging Het
Ighg2c T C 12: 113,288,879 T18A Het
Iqcm A G 8: 75,984,239 K472E possibly damaging Het
Kcnk5 A T 14: 20,142,049 V348D probably benign Het
Kcns3 C T 12: 11,119,800 probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Muc5ac A G 7: 141,812,356 D2787G possibly damaging Het
Nasp A G 4: 116,614,379 C84R probably damaging Het
Nfia G A 4: 97,783,125 R24H probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr330 T C 11: 58,529,764 D74G probably damaging Het
Opa3 C T 7: 19,255,541 R110C probably damaging Het
Papd7 A G 13: 69,515,796 L268P probably damaging Het
Pdia4 A C 6: 47,798,483 S464R possibly damaging Het
Rab3gap2 A G 1: 185,277,163 D1092G probably damaging Het
Rev3l A G 10: 39,854,768 K2763E possibly damaging Het
Sorbs1 A T 19: 40,326,574 L598Q probably damaging Het
Sppl2b A T 10: 80,862,973 M154L probably benign Het
Stk33 A G 7: 109,321,517 I331T probably damaging Het
Strip2 A G 6: 29,933,036 E494G probably benign Het
Supt6 C T 11: 78,221,226 R1010Q possibly damaging Het
Tada1 G A 1: 166,382,436 R69H probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tomm34 A G 2: 164,070,465 probably null Het
Tpi1 T C 6: 124,811,908 T223A probably damaging Het
Trpc3 T A 3: 36,655,130 N399I probably benign Het
Vgll2 A G 10: 52,027,539 H166R probably damaging Het
Vmn2r107 A T 17: 20,356,789 I350F possibly damaging Het
Vmn2r114 T A 17: 23,308,238 K440M probably damaging Het
Vmn2r55 T C 7: 12,651,866 Y729C possibly damaging Het
Zfp106 G T 2: 120,522,716 A1554E probably damaging Het
Zfyve27 A G 19: 42,181,558 Y176C probably damaging Het
Zswim5 T A 4: 116,965,744 N470K probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6758:0610010F05Rik UTSW 11 23588475 splice site probably null
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
R7255:0610010F05Rik UTSW 11 23620465 missense probably benign 0.41
R7286:0610010F05Rik UTSW 11 23622479 missense probably benign 0.07
R7603:0610010F05Rik UTSW 11 23566191 missense probably benign
R7618:0610010F05Rik UTSW 11 23584550 missense possibly damaging 0.91
R7717:0610010F05Rik UTSW 11 23606757 missense probably benign 0.05
R8110:0610010F05Rik UTSW 11 23576764 missense probably benign
R8677:0610010F05Rik UTSW 11 23595471 missense probably benign 0.24
R9165:0610010F05Rik UTSW 11 23615244 missense probably benign 0.00
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Z1177:0610010F05Rik UTSW 11 23624960 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTCATTATATGGAGGATGGCGTAG -3'
(R):5'- TTGTGTAGACATCGCTGGCC -3'

Sequencing Primer
(F):5'- GTAGCATGCCTATACTTTGTTTCAC -3'
(R):5'- GTAGACATCGCTGGCCTTCCC -3'
Posted On 2022-02-07