Incidental Mutation 'R9175:Sanbr'
ID 696633
Institutional Source Beutler Lab
Gene Symbol Sanbr
Ensembl Gene ENSMUSG00000042208
Gene Name SANT and BTB domain regulator of CSR
Synonyms 0610010F05Rik
MMRRC Submission 068948-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R9175 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23514961-23583639 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 23534518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
AlphaFold Q68FF0
Predicted Effect probably benign
Transcript: ENSMUST00000043356
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093267
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155903
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180260
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G A 7: 12,249,412 (GRCm39) D82N probably benign Het
Abca13 A G 11: 9,531,593 (GRCm39) K4607E probably damaging Het
Agpat4 G C 17: 12,417,669 (GRCm39) G70A probably damaging Het
Ank2 G A 3: 126,722,402 (GRCm39) T1017I possibly damaging Het
C2cd2 T C 16: 97,678,421 (GRCm39) I339V probably benign Het
Cacna1a A T 8: 85,296,644 (GRCm39) N1221Y probably damaging Het
Cacna1e A G 1: 154,274,314 (GRCm39) V2197A probably damaging Het
Ccdc74a T C 16: 17,468,042 (GRCm39) S101P probably benign Het
Cdh13 A T 8: 119,968,968 (GRCm39) I442F probably damaging Het
Cnot2 A T 10: 116,334,051 (GRCm39) M373K possibly damaging Het
Coch C A 12: 51,645,060 (GRCm39) H205N possibly damaging Het
Col6a4 A G 9: 105,957,560 (GRCm39) V88A probably benign Het
Erich3 A G 3: 154,419,601 (GRCm39) T35A probably benign Het
Gm28360 A T 1: 117,781,328 (GRCm39) K106N possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspg2 T C 4: 137,256,657 (GRCm39) F1467L probably damaging Het
Ighg2c T C 12: 113,252,499 (GRCm39) T18A Het
Iqcm A G 8: 76,710,867 (GRCm39) K472E possibly damaging Het
Kcnk5 A T 14: 20,192,117 (GRCm39) V348D probably benign Het
Kcns3 C T 12: 11,169,801 (GRCm39) probably benign Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Muc5ac A G 7: 141,366,093 (GRCm39) D2787G possibly damaging Het
Nasp A G 4: 116,471,576 (GRCm39) C84R probably damaging Het
Nfia G A 4: 97,671,362 (GRCm39) R24H probably damaging Het
Opa3 C T 7: 18,989,466 (GRCm39) R110C probably damaging Het
Or2t48 T C 11: 58,420,590 (GRCm39) D74G probably damaging Het
Or8k25 A G 2: 86,244,099 (GRCm39) I99T probably benign Het
Pdia4 A C 6: 47,775,417 (GRCm39) S464R possibly damaging Het
Rab3gap2 A G 1: 185,009,360 (GRCm39) D1092G probably damaging Het
Rev3l A G 10: 39,730,764 (GRCm39) K2763E possibly damaging Het
Sorbs1 A T 19: 40,315,018 (GRCm39) L598Q probably damaging Het
Sppl2b A T 10: 80,698,807 (GRCm39) M154L probably benign Het
Stk33 A G 7: 108,920,724 (GRCm39) I331T probably damaging Het
Strip2 A G 6: 29,933,035 (GRCm39) E494G probably benign Het
Supt6 C T 11: 78,112,052 (GRCm39) R1010Q possibly damaging Het
Tada1 G A 1: 166,210,005 (GRCm39) R69H probably damaging Het
Tent4a A G 13: 69,663,915 (GRCm39) L268P probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tomm34 A G 2: 163,912,385 (GRCm39) probably null Het
Tpi1 T C 6: 124,788,871 (GRCm39) T223A probably damaging Het
Trpc3 T A 3: 36,709,279 (GRCm39) N399I probably benign Het
Vgll2 A G 10: 51,903,635 (GRCm39) H166R probably damaging Het
Vmn2r107 A T 17: 20,577,051 (GRCm39) I350F possibly damaging Het
Vmn2r114 T A 17: 23,527,212 (GRCm39) K440M probably damaging Het
Vmn2r55 T C 7: 12,385,793 (GRCm39) Y729C possibly damaging Het
Zfp106 G T 2: 120,353,197 (GRCm39) A1554E probably damaging Het
Zfyve27 A G 19: 42,169,997 (GRCm39) Y176C probably damaging Het
Zswim5 T A 4: 116,822,941 (GRCm39) N470K probably benign Het
Other mutations in Sanbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sanbr APN 11 23,545,434 (GRCm39) missense probably damaging 1.00
IGL01444:Sanbr APN 11 23,570,225 (GRCm39) splice site probably benign
IGL01522:Sanbr APN 11 23,532,865 (GRCm39) critical splice donor site probably null
IGL01819:Sanbr APN 11 23,534,561 (GRCm39) missense probably benign 0.29
IGL02470:Sanbr APN 11 23,565,222 (GRCm39) missense probably damaging 0.99
IGL03046:Sanbr UTSW 11 23,565,150 (GRCm39) missense possibly damaging 0.77
R0139:Sanbr UTSW 11 23,570,214 (GRCm39) splice site probably benign
R0334:Sanbr UTSW 11 23,567,129 (GRCm39) splice site probably benign
R0646:Sanbr UTSW 11 23,525,491 (GRCm39) missense probably damaging 0.99
R1078:Sanbr UTSW 11 23,561,762 (GRCm39) missense probably benign 0.45
R1263:Sanbr UTSW 11 23,570,278 (GRCm39) nonsense probably null
R1471:Sanbr UTSW 11 23,565,222 (GRCm39) missense probably damaging 0.99
R1568:Sanbr UTSW 11 23,539,971 (GRCm39) missense probably damaging 1.00
R2163:Sanbr UTSW 11 23,526,826 (GRCm39) splice site probably benign
R2318:Sanbr UTSW 11 23,538,701 (GRCm39) missense probably damaging 1.00
R2426:Sanbr UTSW 11 23,526,801 (GRCm39) missense probably damaging 1.00
R4373:Sanbr UTSW 11 23,565,265 (GRCm39) splice site probably null
R4688:Sanbr UTSW 11 23,543,449 (GRCm39) missense probably benign
R4816:Sanbr UTSW 11 23,565,243 (GRCm39) missense possibly damaging 0.67
R5046:Sanbr UTSW 11 23,570,354 (GRCm39) missense probably benign 0.23
R5156:Sanbr UTSW 11 23,543,424 (GRCm39) critical splice donor site probably null
R5249:Sanbr UTSW 11 23,525,483 (GRCm39) makesense probably null
R5615:Sanbr UTSW 11 23,556,759 (GRCm39) missense probably damaging 0.96
R6758:Sanbr UTSW 11 23,538,475 (GRCm39) splice site probably null
R6860:Sanbr UTSW 11 23,575,100 (GRCm39) missense probably damaging 1.00
R6910:Sanbr UTSW 11 23,570,447 (GRCm39) missense probably damaging 0.99
R7255:Sanbr UTSW 11 23,570,465 (GRCm39) missense probably benign 0.41
R7286:Sanbr UTSW 11 23,572,479 (GRCm39) missense probably benign 0.07
R7603:Sanbr UTSW 11 23,516,191 (GRCm39) missense probably benign
R7618:Sanbr UTSW 11 23,534,550 (GRCm39) missense possibly damaging 0.91
R7717:Sanbr UTSW 11 23,556,757 (GRCm39) missense probably benign 0.05
R8110:Sanbr UTSW 11 23,526,764 (GRCm39) missense probably benign
R8677:Sanbr UTSW 11 23,545,471 (GRCm39) missense probably benign 0.24
R9165:Sanbr UTSW 11 23,565,244 (GRCm39) missense probably benign 0.00
R9526:Sanbr UTSW 11 23,559,098 (GRCm39) missense probably damaging 1.00
R9583:Sanbr UTSW 11 23,531,642 (GRCm39) missense possibly damaging 0.69
R9622:Sanbr UTSW 11 23,534,590 (GRCm39) missense probably damaging 0.99
X0026:Sanbr UTSW 11 23,526,767 (GRCm39) missense probably benign 0.00
X0067:Sanbr UTSW 11 23,543,420 (GRCm39) splice site probably null
Z1177:Sanbr UTSW 11 23,574,960 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTCATTATATGGAGGATGGCGTAG -3'
(R):5'- TTGTGTAGACATCGCTGGCC -3'

Sequencing Primer
(F):5'- GTAGCATGCCTATACTTTGTTTCAC -3'
(R):5'- GTAGACATCGCTGGCCTTCCC -3'
Posted On 2022-02-07