Mutagenetix > Incidental Mutation

Incidental Mutation 'R9175:Vmn2r107'

696644

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

MMRRC Submission

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R9175 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20356789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 350 (I350F)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042090
AA Change: I350F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: I350F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,584,518		probably null	Het
2900092C05Rik	G	A	7: 12,515,485	D82N	probably benign	Het
Abca13	A	G	11: 9,581,593	K4607E	probably damaging	Het
Agpat4	G	C	17: 12,198,782	G70A	probably damaging	Het
Ank2	G	A	3: 126,928,753	T1017I	possibly damaging	Het
C2cd2	T	C	16: 97,877,221	I339V	probably benign	Het
Cacna1a	A	T	8: 84,570,015	N1221Y	probably damaging	Het
Cacna1e	A	G	1: 154,398,568	V2197A	probably damaging	Het
Ccdc74a	T	C	16: 17,650,178	S101P	probably benign	Het
Cdh13	A	T	8: 119,242,229	I442F	probably damaging	Het
Cnot2	A	T	10: 116,498,146	M373K	possibly damaging	Het
Coch	C	A	12: 51,598,277	H205N	possibly damaging	Het
Col6a4	A	G	9: 106,080,361	V88A	probably benign	Het
Erich3	A	G	3: 154,713,964	T35A	probably benign	Het
Gm28360	A	T	1: 117,853,598	K106N	possibly damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Hspg2	T	C	4: 137,529,346	F1467L	probably damaging	Het
Ighg2c	T	C	12: 113,288,879	T18A		Het
Iqcm	A	G	8: 75,984,239	K472E	possibly damaging	Het
Kcnk5	A	T	14: 20,142,049	V348D	probably benign	Het
Kcns3	C	T	12: 11,119,800		probably benign	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Muc5ac	A	G	7: 141,812,356	D2787G	possibly damaging	Het
Nasp	A	G	4: 116,614,379	C84R	probably damaging	Het
Nfia	G	A	4: 97,783,125	R24H	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr330	T	C	11: 58,529,764	D74G	probably damaging	Het
Opa3	C	T	7: 19,255,541	R110C	probably damaging	Het
Papd7	A	G	13: 69,515,796	L268P	probably damaging	Het
Pdia4	A	C	6: 47,798,483	S464R	possibly damaging	Het
Rab3gap2	A	G	1: 185,277,163	D1092G	probably damaging	Het
Rev3l	A	G	10: 39,854,768	K2763E	possibly damaging	Het
Sorbs1	A	T	19: 40,326,574	L598Q	probably damaging	Het
Sppl2b	A	T	10: 80,862,973	M154L	probably benign	Het
Stk33	A	G	7: 109,321,517	I331T	probably damaging	Het
Strip2	A	G	6: 29,933,036	E494G	probably benign	Het
Supt6	C	T	11: 78,221,226	R1010Q	possibly damaging	Het
Tada1	G	A	1: 166,382,436	R69H	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tomm34	A	G	2: 164,070,465		probably null	Het
Tpi1	T	C	6: 124,811,908	T223A	probably damaging	Het
Trpc3	T	A	3: 36,655,130	N399I	probably benign	Het
Vgll2	A	G	10: 52,027,539	H166R	probably damaging	Het
Vmn2r114	T	A	17: 23,308,238	K440M	probably damaging	Het
Vmn2r55	T	C	7: 12,651,866	Y729C	possibly damaging	Het
Zfp106	G	T	2: 120,522,716	A1554E	probably damaging	Het
Zfyve27	A	G	19: 42,181,558	Y176C	probably damaging	Het
Zswim5	T	A	4: 116,965,744	N470K	probably benign	Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2009:Vmn2r107	UTSW	17	20375467	missense	probably benign	0.01
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3740:Vmn2r107	UTSW	17	20374889	missense	probably benign	0.00
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4270:Vmn2r107	UTSW	17	20355779	missense	probably benign
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6007:Vmn2r107	UTSW	17	20375054	missense	probably benign	0.19
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9537:Vmn2r107	UTSW	17	20374887	missense	probably benign	0.00
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GGTCTAATGCGAAATATTGGGC -3'
(R):5'- GTCTCATCTCATGGAGGCTG -3'

Sequencing Primer
(F):5'- ATTGGGCAAAGGTTATTGACATGGC -3'
(R):5'- CTCATCTCATGGAGGCTGTGAGC -3'

Posted On

2022-02-07